Because your literal adapter is also matching the beginning of the read entire sequence to the right is removed (ktrim=r). If you change the sequence at the beginning by one base you will see that the initial part is retained as you expect.
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Hi Brian,
I would like to switch from solexaqa to BBduk for my read trim and filtering option, however since we are working with bacterial strains typification we would like to have the option to only keep trimmed reads where no individual base has a quality lower than a defined threshold (instead of average region quality). Could this be done with BBduk?
Thanks!
Comment
-
Hi cuencam,
It is currently not possible to do this, other than discarding all reads that have any undefined (quality 0) bases with "maxns=0". I never saw a reason to discard all reads with a single base below a specified cutoff. It would be simple enough to add (or implement via a custom script), but can you explain why you're doing it? The "average region quality" method is the best at maximizing coverage while minimizing the total number of errors.
Edit - anyway, it was quick to add, so it will be in the next release as the "mbq" ("minbasequality") flag.Last edited by Brian Bushnell; 08-14-2017, 10:44 AM.
Comment
-
Hi Brian,
Thanks for such a quick response, and implementing this so fast!
Our interest is that during SNV calling in low coverage regions or low abundance taxa (in metagenomics) base quality can be more important than coverage. This way we can assess properly different alleles and avoid the creation of artifacts
Cheers!
Edit - Do you have an estimated next release date?
Comment
-
Hi Brian,
In the same lines of my previous question, what is the rationale of using maq=10? We are interesting in de novo assembly of metagenomic data and we were worried that low quality bases at the ends of the reads might feed artificial k-mers in to the assembler (SPADES). I read that you recommend read normalization, but since our coverage is highly unequal (due to unequal species abundance, not because sequencing artifacts) we are worried that this might introduce more biases than the ones it solves.
We were thinking on using your newly implemented option "mbq" to secure that all bases have 20 as minimum quality. Do you believe that this is a good alternative?
Comment
-
"maq=10" is to throw away really junky reads. The only way to really verify whether a setting is beneficial is to actually test it, unfortunately. But personally, I think "mbq=20" would be too aggressive (particularly if your sequencing run had a single low-quality cycle, in which case it would discard all of the data)... if you really want to get rid of the low-quality trailing bases, I'd suggest quality-trimming instead (qtrim=r trimq=14 or something like that). Spades is pretty robust with respect to low-quality data anyway; the biggest problem is that it low quality reads balloon the kmer-space which can make it run out of memory.
The main advantage of normalization with metagenomes, in fact, is that it removes a lot of data which allows Spades to run on datasets that it can't otherwise handle. It's not strictly beneficial and if you can assemble a metagenome without normalization, that may be better - sometimes normalization improves the assembly, sometimes it doesn't.
Comment
-
Thanks for this response! I'm pretty sure that your excellent user support is only comparable to the high quality of your tools!
I will implement quality-trimming at a higher threshold and then test. I do agree that mbq=20 is hard for assembly (but probably useful for SNV).
Cheers
Comment
-
Hi Brian,
I tried to filter reads longer 10bp. I used the following command:
Code:bbduk.sh -in=input.fq -out=output.fq -maxlength=10
I used the latest version of bbduk 37.53
Test Input:
Code:@test ACTGGACTTGGAGTCAGAAGGC + b\\[\ZZ[][a]_]]cbbbabc
Code:Input: 1 reads 22 bases. Total Removed: 0 reads (0.00%) 0 bases (0.00%) Result: 1 reads (100.00%) 22 bases (100.00%)
Comment
-
Hi EssigSchurke
The flag is minlength=10
The whole command is
bbduk.sh in=input.fq out=output.fq minlength=10
Edit:
I misread your question. The command provided by jazz710 is the appropriate, and works on my computer. You want to remove the big reads, correct?Last edited by cuencam; 09-15-2017, 05:33 AM.
Comment
-
Actually, all the BBTools strip off the leading "-" so you can put as many of them as you want
This is a bug. Thanks for the report! It looks like BBDuk only removes reads under minlen or over maxlen if they were trimmed; untrimmed sequences will pass regardless of their length. Sorry about that! Reformat actually works correctly in this case, though:
Code:reformat.sh in=x.fq out=y.fq minlen=A maxlen=B
Comment
Latest Articles
Collapse
-
by seqadmin
While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...-
Channel: Articles
06-06-2024, 07:15 AM -
-
by seqadmin
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...-
Channel: Articles
05-24-2024, 01:16 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 06-07-2024, 06:58 AM
|
0 responses
13 views
0 likes
|
Last Post
by seqadmin
06-07-2024, 06:58 AM
|
||
Started by seqadmin, 06-06-2024, 08:18 AM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
06-06-2024, 08:18 AM
|
||
Started by seqadmin, 06-06-2024, 08:04 AM
|
0 responses
22 views
0 likes
|
Last Post
by seqadmin
06-06-2024, 08:04 AM
|
||
Started by seqadmin, 06-03-2024, 06:55 AM
|
0 responses
15 views
0 likes
|
Last Post
by seqadmin
06-03-2024, 06:55 AM
|
Comment