CutAdapt Statistic output

[lwhitmore]

Hey,
I am a first cut adapt user and was alittle confused by the statistic output

Here is the output
=== Adapter 1 ===

Adapter 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT', length 33, was trimmed 2371637 times.

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Overview of removed sequences
length count expect max.err error counts
3 195855 121796.5 0 195855
4 101281 30449.1 0 101281
5 81153 7612.3 0 81153
6 75593 1903.1 0 75593
7 74197 475.8 0 74197
8 72866 118.9 0 72866
9 72255 29.7 0 72086 169

Based on the information provided above the 0-9 bases removed should have an error rate of 0.

However if you look at the bottom line which says 9 bases are being removed from the read, the max error rate is 0, we still see error of 1 being allowed the 169. Can anyone explain why this might be happening

Thanks
Leanne

[Brian Bushnell]

That's interesting; sounds like a bug, though not a very important one. But if I can make a suggestion, you should probably be using BBDuk instead In my tests, it's much faster and more accurate.