Tweet
I just don't get it, do I need to remove these reads from my .bam file?
-
-
They are "unexpected". One part of the read goes to one region of the genome, the other part of the read goes to another (not nearby) part of the genome, possibly another chromsome.
Though in this terminology it also means "fusion genes".
They are interesting in Cancer studies (and other studies).
What exactly are you doing?
Typically, you don't need to remove them. -
I made another post about an issue that I had with supplementary alignments.
I mapped my reads using bwa, then I filtered out the .bam file so I could obtain the unmapped reads.
Then I tried to convert the .bam file to 2 paired end .fq files, but I got this warning:
*****WARNING: Query M00532:8:000000000-A17VF:1:2114:24702:5749 is marked as paired, but it's mate does not occur next to it in your BAM file. Skipping.
The SAM flag for all these reads is 2121 and it appears such as this:
M00532:8:000000000-A17VF:1:2114:24702:5749 73 NODE_321_length_580971_cov_15.123657 246952 60 88S167M = 246952 0 CCTGTTCGTCGTTGCCCCCCCCCACCCCCCCCCCCTCCCCCCCCCACCCCCCCCCCCCCCCCCCACCGCCCACCCCCCCCCCCCCCCAGGCGCGGTTATCCAGCATTTTCACGTTCAGCTTCAGCTGGCTCAGTTGATCCACCAGCTGTTGATCGGCCATGGCGCTACCCATAACGCCCAAGAATCCACACGCTGCCGTCAAAGCGGCAAGCGCGCTCAGTTTGAATGCGTTCATCTTCTCATCCTTCCTAATTA ,5,,557555555555866655C555CCHH55C44)444=B1222'.0A...5....8<D.'..'.0)..
08ADDDD......'.'.......).00?CE?EE?AEEEEEE8?EEEEEEEC::CE?A?CECC?CEEEEEEEECC*0*:?::?AEDE?CA?CDE2'.AEEC?*0)...00.00*0:*0*0'.)).0...0)*0*0'.2;8888'4')8:***0*0***)08):******00*******00:??* NM:i:8 MD:Z:78C6C13C0A0T2T9G45T6 AS:i:127 XS:i:19 RG:Z:cof1 SA:Z:NODE_281_length_33_cov_9.606061,2,+,14S50M191S,18,2;
M00532:8:000000000-A17VF:1:2114:24702:5749 2121 NODE_281_length_33_cov_9.606061 2 18 14H50M191H = 2 0 CCCCCCCCCACCCCCCCCCCCTCCCCCCCCCACCCCCCCCCCCCCCCCCC 55866655C555CCHH55C44)444=B1222'.0A...5....8<D.'.. NM:i:2 MD:Z:9C11C28 AS:i:40 XS:i:33 RG:Z:cof1 SA:Z:NODE_321_length_580971_cov_15.123657,246952,+,88S167M,60,8; XA:Z:NODE_281_length_33_cov_9.606061,+1,39S48M168S,3;NODE_281_length_33_cov_9.606061,+24,14S42M199S,2;
M00532:8:000000000-A17VF:1:2114:24702:5749 133 NODE_321_length_580971_cov_15.123657 246952 0 * = 246952 0 GCCTGTGCGCAACCCGCCGCGCCGCCGCCCTCCCCCCCCTTTTCTCCTTCTTCCCCCCCCTTCCTCCCCTCCTCCCCCCCTCCTCCTCCTCCCCCCCTCCCCTTCCTTTCGGTGCTGAACGTGCTGAAACAAGTAAATTTTATCTTCAAGACTACTGATTTGAATACTATTCATGACCCGGAATATAAGCACTGCATTATGCCTATTTTCAGACATTCTCAAAATACAGTGATCACCCACACAGTTCTCCTCTCC ,,,,,<-<@7@@@@@@6+655++555+555*5C+>CCCC);++4+4=++224@2;9
28:008;@E99(66(;;((.''-(//66.(.//(-('..'(//96-6((/..('/('((/(/((--((./((<((/(/(////(/(/(/(./(/((//((///(((/((/(/(/(/((//6''''(/(((.(/;((/6((/66((/(////((((/(//((/((((/(/(((((((/(((((-(((/(/(./(/((( AS:i:0 XS:i:0 RG:Z:cof1
Comment
-
2121 is not a valid flag. Odd.Comment
-
Comment
-
My mistake; the last flag bit, "supplementary alignment", is new. Time to download a new version of the sam format specification
Comment
-
bump still need helpComment
-
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...07-20-2026, 11:48 AM -
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...07-09-2026, 11:10 AM -
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...07-08-2026, 05:17 AM
Comment