Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • prs321
    Member
    • Jun 2013
    • 96

    #1

    What are chimeric reads?

    I just don't get it, do I need to remove these reads from my .bam file?
  • Richard Finney
    Senior Member
    • Feb 2009
    • 701

    #2
    They are "unexpected". One part of the read goes to one region of the genome, the other part of the read goes to another (not nearby) part of the genome, possibly another chromsome.



    Though in this terminology it also means "fusion genes".

    They are interesting in Cancer studies (and other studies).

    What exactly are you doing?

    Typically, you don't need to remove them.

    Comment

    • prs321
      Member
      • Jun 2013
      • 96

      #3
      I made another post about an issue that I had with supplementary alignments.

      I mapped my reads using bwa, then I filtered out the .bam file so I could obtain the unmapped reads.

      Then I tried to convert the .bam file to 2 paired end .fq files, but I got this warning:

      *****WARNING: Query M00532:8:000000000-A17VF:1:2114:24702:5749 is marked as paired, but it's mate does not occur next to it in your BAM file. Skipping.


      The SAM flag for all these reads is 2121 and it appears such as this:

      M00532:8:000000000-A17VF:1:2114:24702:5749 73 NODE_321_length_580971_cov_15.123657 246952 60 88S167M = 246952 0 CCTGTTCGTCGTTGCCCCCCCCCACCCCCCCCCCCTCCCCCCCCCACCCCCCCCCCCCCCCCCCACCGCCCACCCCCCCCCCCCCCCAGGCGCGGTTATCCAGCATTTTCACGTTCAGCTTCAGCTGGCTCAGTTGATCCACCAGCTGTTGATCGGCCATGGCGCTACCCATAACGCCCAAGAATCCACACGCTGCCGTCAAAGCGGCAAGCGCGCTCAGTTTGAATGCGTTCATCTTCTCATCCTTCCTAATTA ,5,,557555555555866655C555CCHH55C44)444=B1222'.0A...5....8<D.'..'.0)..08ADDDD......'.'.......).00?CE?EE?AEEEEEE8?EEEEEEEC::CE?A?CECC?CEEEEEEEECC*0*:?::?AEDE?CA?CDE2'.AEEC?*0)...00.00*0:*0*0'.)).0...0)*0*0'.2;8888'4')8:***0*0***)08):******00*******00:??* NM:i:8 MD:Z:78C6C13C0A0T2T9G45T6 AS:i:127 XS:i:19 RG:Z:cof1 SA:Z:NODE_281_length_33_cov_9.606061,2,+,14S50M191S,18,2;
      M00532:8:000000000-A17VF:1:2114:24702:5749 2121 NODE_281_length_33_cov_9.606061 2 18 14H50M191H = 2 0 CCCCCCCCCACCCCCCCCCCCTCCCCCCCCCACCCCCCCCCCCCCCCCCC 55866655C555CCHH55C44)444=B1222'.0A...5....8<D.'.. NM:i:2 MD:Z:9C11C28 AS:i:40 XS:i:33 RG:Z:cof1 SA:Z:NODE_321_length_580971_cov_15.123657,246952,+,88S167M,60,8; XA:Z:NODE_281_length_33_cov_9.606061,+1,39S48M168S,3;NODE_281_length_33_cov_9.606061,+24,14S42M199S,2;
      M00532:8:000000000-A17VF:1:2114:24702:5749 133 NODE_321_length_580971_cov_15.123657 246952 0 * = 246952 0 GCCTGTGCGCAACCCGCCGCGCCGCCGCCCTCCCCCCCCTTTTCTCCTTCTTCCCCCCCCTTCCTCCCCTCCTCCCCCCCTCCTCCTCCTCCCCCCCTCCCCTTCCTTTCGGTGCTGAACGTGCTGAAACAAGTAAATTTTATCTTCAAGACTACTGATTTGAATACTATTCATGACCCGGAATATAAGCACTGCATTATGCCTATTTTCAGACATTCTCAAAATACAGTGATCACCCACACAGTTCTCCTCTCC ,,,,,<-<@7@@@@@@6+655++555+555*5C+>CCCC);++4+4=++224@2;928:008;@E99(66(;;((.''-(//66.(.//(-('..'(//96-6((/..('/('((/(/((--((./((<((/(/(////(/(/(/(./(/((//((///(((/((/(/(/(/((//6''''(/(((.(/;((/6((/66((/(////((((/(//((/((((/(/(((((((/(((((-(((/(/(./(/((( AS:i:0 XS:i:0 RG:Z:cof1

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        2121 is not a valid flag. Odd.

        Comment

        • prs321
          Member
          • Jun 2013
          • 96

          #5
          Originally posted by Brian Bushnell View Post
          2121 is not a valid flag. Odd.


          The calculator says it is valid? I have no clue

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            #6
            My mistake; the last flag bit, "supplementary alignment", is new. Time to download a new version of the sam format specification

            Comment

            • prs321
              Member
              • Jun 2013
              • 96

              #7
              bump still need help

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 08-13-2026, 12:22 PM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-11-2026, 10:35 AM
              0 responses
              24 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-06-2026, 07:41 AM
              0 responses
              38 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              51 views
              0 reactions
              Last Post SEQadmin2  
              Working...