Hi yh253
Your GTF file does look strange. It is important that all exons from the same gene have the same gene_id. However, in your GTF file, the gene_id and the transcript_id seems to be the same. So, if a read maps to an exon shared by two transcripts of the same gene, htseq-count will see two different gene IDs and think that it is two different genes although it is only two different transcripts of the same gene.
It seems that UCSC and Ensembl disagree about what the point of the gene_id attribute in GTF files is. Maybe, try again with the GTF file from Ensembl. (But make sure the coordinates are the same.)
And make sure that strand option is set correctly.
Simon
Unconfigured Ad
Collapse
X
-
Hi Simon,
I tried to use 'htseq-count' to count reads on UCSC hg19 known genes. My data is single end Illumina reads aligned to UCSC hg19 by bowtie with upto 10 multiple alignment allowed.
The GTF file was downloaded from UCSC known gene table:$head -n 30 test.sam
@HD VN:1.0 SO:unsorted
@SQ SN:chr1 LN:249250621
@SQ SN:chr2 LN:243199373
@SQ SN:chr3 LN:198022430
@SQ SN:chr4 LN:191154276
@SQ SN:chr5 LN:180915260
@SQ SN:chr6 LN:171115067
@SQ SN:chr7 LN:159138663
@SQ SN:chr8 LN:146364022
@SQ SN:chr9 LN:141213431
@SQ SN:chr10 LN:135534747
@SQ SN:chr11 LN:135006516
@SQ SN:chr12 LN:133851895
@SQ SN:chr13 LN:115169878
@SQ SN:chr14 LN:107349540
@SQ SN:chr15 LN:102531392
@SQ SN:chr16 LN:90354753
@SQ SN:chr17 LN:81195210
@SQ SN:chr18 LN:78077248
@SQ SN:chr19 LN:59128983
@SQ SN:chr20 LN:63025520
@SQ SN:chr21 LN:48129895
@SQ SN:chr22 LN:51304566
@SQ SN:chrX LN:155270560
@SQ SN:chrY LN:59373566
@SQ SN:chrM LN:16571
@PG ID:Bowtie VN:0.12.5 CL:"/bowtie -t -p 4 -v 2 -k 11 -m 10 --strata --best --sam hg19 test.fq test.sam"
HWI-EAS283_0007:1:1:1029:14030#NGCTAT/1 0 chrM 9647 255 30M * 0 0 CTCACCATAGTCTAATAGAAAACANNCGAA CCCCCCCCCACCCCCCCCCC########## XA:i:2 MD:Z:24A0C4 NM:i:2
HWI-EAS283_0007:1:1:1029:14030#NGCTAT/1 0 chr1 570195 255 30M * 0 0 CTCACCATAGTCTAATAGAAAACANNCGAA CCCCCCCCCACCCCCCCCCC########## XA:i:2 MD:Z:24A0C4 NM:i:2
HWI-EAS283_0007:1:1:1029:3318#NGCTAT/1 16 chr6 43491059 255 30M * 0 0 GAACNNACCAAGTTCTCTTCAGCACTTAGC ##########CCC;CCCBCCCCCCC@CCCC XA:i:2 MD:Z:4T0G24 NM:i:2
I issued the following command to do the count:$ head knownGene_hg19.gtf
chr1 hg19_knownGene exon 11874 12227 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
chr1 hg19_knownGene exon 12613 12721 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
chr1 hg19_knownGene exon 13221 14409 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
chr1 hg19_knownGene start_codon 12190 12192 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene CDS 12190 12227 0.000000 + 0 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene exon 11874 12227 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene CDS 12595 12721 0.000000 + 1 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene exon 12595 12721 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene CDS 13403 13636 0.000000 + 0 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
chr1 hg19_knownGene stop_codon 13637 13639 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
However, only 30% of my reads successfully mapped to known genes, and over 50% of them were taken as 'ambiguous'. This happened to all my samples ( 2 samples with 4 biological replicates for each) by using any of the three modes: union/intersection-strict/intersection-nonempty. Do you think this is a problem with my gtf file or 'htseq-count' doesn't work well with my data? I appreciate any input!htseq-count --stranded=no test.sam knownGene_hg19.gtf > test.count
$tail test.count
uc011nbv.1 0
uc011nbw.1 0
uc011nbx.1 0
uc011nby.1 0
uc011nbz.1 0
uc011nca.1 0
uc011ncb.1 0
uc011ncc.1 10
no_feature 1886981
ambiguous 3142708
Leave a comment:
-
Hello Simon,
HTSeq seems to be the right tool I need for my work. I am trying to count how many times each base in an interesting region of exon has been covered by a read. Can 'counting' function in HTSeq do that? If so, how to do it?
Thanks
Leave a comment:
-
Simon,Originally posted by Simon Anders View PostHi
I don't have much experience with SOLiD data, but I'd be interested to collaborate with a SOLiD-using bioinformatician to fill in the gaps in order to make HTSeq really useful for colour-space data. I think not much is missing for this.
Cheers
Simon
I am testing htseq-count on SOLiD data. The sam file was generated using SHRiMP. It reported the following error message:
Error occured in line 1 of file rat1.saet.shrimp.sam.
Error: ("'seq' and 'qualstr' do not have the same length.", 'line 1 of file rat1.saet.shrimp.sam')
[Exception type: ValueError, raised in _HTSeq.pyx:621]
And here is the first few lines of the SAM file.
1241_771_1428_F3 0 chr1 12208 255 12H38M * 0 0 ATTGCCTCAGGTTCCCTCCTCAGTGTGTAGTGTGAGAT * AS:i:732 CS:Z:T11221133111133013022120102002202212111113211112113 XX:Z:ATTGCCTCAGGTTCCCTCCTCAGTGTGTAGTGTGAgaT
25_503_796_F3 0 chr1 12290 255 2H48M * 0 0 TGCTGCTTTGATTGTGTCCAGTGCCAAGAAAATGAGATTGCCAATGAT * AS:i:862 CS:Z:T22013213200123011122012113010220030120330130103033 XX:Z:TGCTGCTTTGATTGTGtCCAGTGCCAAGAAAatGAgaTTGCCAATgaT
25_503_796_F3 0 chr1 14756 255 2H48M * 0 0 TGCTGCTTTGATTGTGTCCAGTGCCAAGAAAATGAGATTGCCAATGAT * AS:i:862 CS:Z:T22013213200123011122012113010220030120330130103033 XX:Z:TGCTGCTTTGATTGTGtCCAGTGCCAAGAAAatGAgaTTGCCAATgaT
Do you have any suggestions on how to get around this?
Thanks.
Leave a comment:
-
I am having the same problem as you, when i run HTseq-count I have warnings about improper mate pairs. Tophat sam output contains improper mate pairs (the mate is unmapped) as well as proper pairs. My question is if HTseq-count discards counts comming from improper pairs, if not how to deal with that?I have a great amount of improper pairs.Originally posted by Thomas Doktor View PostI'm trying to use htseq-count version 0.4.2-p3 on a sam file produced by TopHat and a hg19 Ensembl GTF file. I'm analysing the reads in non-stranded mode and looking for exons in the gene_id features. The script runs for a while and outputs several warnings about reads incorrectly flagged as proper pairs, but then exits with the following error:
Is this an error in my sam file and if so how can I identify the read in question?
thanks.
Leave a comment:
-
Hi shurjo
Could you please try again with the newest version, 0.4.4p6? The previous version, p5, had a bug in the error reporting which occludes the actual error message. The p6 version should give you a more informative error message, most likely pointing to a malformed line in your SAM file.
Simon
Leave a comment:
-
Hi Simon,
I am getting the error below when running HTSeq-count with a SAM file produced by TopHatv1.0.14. The script works fine when tested with a smaller subset (head -1000000) from the same SAM file but fails on the bigger file, which has ~75 million reads. Maybe the last line in the error hints at a malformed SAM file?
Any advice is much appreciated,
Thanks,
Shurjo
Code:[sensh@saturn htseq_counts]$ python -m HTSeq.scripts.count -s no rep_C_08010264.SE.accepted_hits.sam ~/GTF_files/Homo_sapiens.withchr.NCBI36.50.gtf > rep_C_08010264.SE.htseq.counts Traceback (most recent call last): File "/home/pchines/lib/python2.6/runpy.py", line 121, in _run_module_as_main "__main__", fname, loader, pkg_name) File "/home/pchines/lib/python2.6/runpy.py", line 34, in _run_code exec code in run_globals File "/home/sensh/.local/lib/python2.6/site-packages/HTSeq-0.4.4p5-py2.6-linux-x86_64.egg/HTSeq/scripts/count.py", line 202, in <module> main() File "/home/sensh/.local/lib/python2.6/site-packages/HTSeq-0.4.4p5-py2.6-linux-x86_64.egg/HTSeq/scripts/count.py", line 191, in main sys.stderr.write( "Error: %s\n" % "; ".join( sys.exc_info()[1] ) ) TypeError: sequence item 0: expected string, int found
Leave a comment:
-
Thanks, Simon. I guess that is about as fundamental as an error can get on my part.
Leave a comment:
-
Hi Shurjo
htseq-count is a command-line tool. You start it from your shell, without first calling python.
Simon
Leave a comment:
-
Hi Simon,
Many thanks for DESeq and HTSeq. I have been using BedTools to get the count data for DESeq analyses but would like to try HTSeq as well. However, after building it from source, I get the following error:
It seems to me that I am missing something at a fundamental level. Any help from your part would be much appreciated.Code:[sensh@saturn ~]$ python Python 2.6 (r26:66714, Oct 2 2008, 16:03:09) [GCC 3.4.6 20060404 (Red Hat 3.4.6-9)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import HTSeq >>> htseq-count --help Traceback (most recent call last): File "<stdin>", line 1, in <module> NameError: name 'htseq' is not defined
Thanks,
Shurjo
Leave a comment:
-
Hi
For Linux, please use the source version, this makes it easier for both of us. Please see here for instructions. (Do not use easy_install, rather, download the source package and install it as described.)Originally posted by townway View PostLinux 2.6.18-194.8.1.el5 #1 SMP Wed Jun 23 10:52:51 EDT 2010 x86_64 x86_64 x86_64 GNU/Linux
Simon
Leave a comment:
-
Hi Keith
At the moment, HTSeq can natively only work with SAM files. Adding BAM support is on my to-do list, and of course, I would do it by simply wrapping the samtools.Originally posted by krobison View PostI see HTSeq can read SAM files & assume it can also read BAM files. Can it retrieve BAM files from a remote (FTP or HTTP) location as samtools can? Is it using the samtools code or have you reimplemented this in Python?
For now, however, you can simply call the 'samtools' binary from Python and pipe its output to HTSeq's SAM_Reader class. The following function does that for you:
With this, you can now do, e.g.:Code:import subprocess import HTSeq def BAM_Region_Reader( bamfile, region=None, samtools_exec="samtools" ): """Get Reader object for part of a BAM file bamfile -- a string, either a file name or an URL to a BAM file region -- a GenomicInterval samtools_exec -- file name (with path, if necessary) of the 'samtools' executable Returns a SAM_Reader object. """ cmd_line = ( samtools_exec , "view", bamfile ) if region is not None: cmd_line += ( "%s:%d-%d" % ( region.chrom, region.start, region.end ), ) samtools_view = subprocess.Popen( cmd_line, stdout = subprocess.PIPE ) return HTSeq.SAM_Reader( samtools_view.stdout )
Maybe not the optimum in performance but should do the job.Code:bamfile = "ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data/HG00155/alignment/HG00155.chrom12.ILLUMINA.bwa.GBR.low_coverage.20100517.bam" region = HTSeq.GenomicInterval( "12", 90000, 91000, "." ) for alignment in BAM_Region_Reader( bamfile, region ): print alignment
Cheers
Simon
Leave a comment:
-
Hi Simon,
I have a question about qval in DESeq, when I do not have biological replicate and then analyze two samples? How does DESeq calculate the pval. Sorry I have read your paper, but the formula is very complicated for me? Can you explain this to me?
Thanks a lot!
Wei
Leave a comment:
-
Apologies if this is a series of dumb questions.
I see HTSeq can read SAM files & assume it can also read BAM files. Can it retrieve BAM files from a remote (FTP or HTTP) location as samtools can? Is it using the samtools code or have you reimplemented this in Python?
thanks
Keith R.
Leave a comment:
-
Linux 2.6.18-194.8.1.el5 #1 SMP Wed Jun 23 10:52:51 EDT 2010 x86_64 x86_64 x86_64 GNU/Linux
Thank you
Leave a comment:
Latest Articles
Collapse
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
09-01-2026, 05:41 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 09-25-2026, 09:06 AM
|
0 responses
20 views
0 reactions
|
Last Post
by SEQadmin2
09-25-2026, 09:06 AM
|
||
|
Started by SEQadmin2, 09-23-2026, 11:05 AM
|
0 responses
22 views
0 reactions
|
Last Post
by SEQadmin2
09-23-2026, 11:05 AM
|
||
|
Started by SEQadmin2, 09-18-2026, 11:37 AM
|
1 response
43 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:04 AM
|
||
|
Started by SEQadmin2, 09-16-2026, 10:23 AM
|
1 response
55 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:12 AM
|
Leave a comment: