Thanks kmcarr!
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
@frymor's question is also posted (and possibly answered) on Biostars: https://www.biostars.org/p/167555/
Comment
-
Originally posted by daanum View PostHi ,
I am using a Linux GNU server. How can I view the.html files which are generated as a result of fastqc, on the linux server?
Thank you.
Comment
-
Originally posted by GenoMax View PostYou don't have to view them on the server. The files are self contained and can be transferred to local desktop PC/Mac for stand-alone examination.
Comment
-
Hello Simon & all,
first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.
second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?
Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.
Comment
-
Originally posted by apredeus View PostHello Simon & all,
first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.
second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?
Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.
For your Ion Torrent data you shouldn't need to do anything different to work with that. For the overrepresented sequences we only take up to the first 50bp of each read anyway as we're using an exact matching strategy to count duplicates, so if you allow longer lengths then your results get increasingly messed up by mis-calls, and 50bp is normally enough to establish that it's the same sequence.
Comment
-
fastQC
Originally posted by simonandrews View PostAaargh - I'd forgotten that one of the other pending fixes for the next release was that the disable didn't work for the per-tile module (it will actually disable it if you turn of the adapter module as it was reading the wrong parameter).
I've just put up a development snapshot at http://www.bioinformatics.babraham.a...11.3_devel.zip which contains the fix for both of these issues. You should be able to use that to process these files.
Comment
-
Originally posted by Roxana View PostDear Simon, I have the same problem with my fastq file (from nanopore sequencing). Please, could you provide the link for download the fastQC version0.11.3 for Mac? Many thanks!!!
Comment
-
Dear genoMax,
I tried to running in the version 0.11.5, but it is not working with my fastq file (from nanopore sequencing). Please, see below the error:
Code:[rzz1@spectre14 ~]$ Picked up JAVA_TOOL_OPTIONS: -XX:MaxHeapSize=2048m Exception in thread "Thread-1" java.lang.OutOfMemoryError: Java heap space at uk.ac.babraham.FastQC.Utilities.QualityCount.<init>(QualityCount.java:33) at uk.ac.babraham.FastQC.Modules.PerBaseQualityScores.processSequence(PerBaseQualityScores.java:141) at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:88) at java.lang.Thread.run(Thread.java:748)
Code:@9157abfa-c2e8-4d54-a323-11162850dcbf runid=4243c40e101f8b1c6aa3337f2ef28b72eef6091c read=5 ch=78 start_time=2017-05-19T15:31:04Z ATTTATGTTCTTGGCCCCCACACATTGTGGCCCCCATTGTTGTGTGTGTGTTATTTGACCCTTGTATTTGTATTGTTATTGTGTTATTGTTGGCCCCATTATTGTGTGTGTATTATTGTTATTTGACCCATTGTTGTATTGTGTGTGACTTGTGTGTGTGTATTATTGTTATTGTGTATTATTTGTGTGTGTGTGTGTGTGCTTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCTCTATACTCTATATATATATACCTATATACTCTTCTTCTTCTTCTCTTCTTTCTCTCTTATGTCTTTCTCTTCTCTTCTTCTTATACCACTTCTTCTTCTATTCTAATAAATTAGGATGGGAGGAGGATGGATGGGTTCAAGGATAGTTCAATGAATACAAGGAGAGGAAAAAGGATC + $''$#&$&'$''""$$$$$#$#%%)+&)&%&(())'..')(%)&'$*&)#&+$(*('$%(')*%*"')+#'#*,$,*$*)%&%()#,(&1+('()('(+4'/*()$'#%#'#'+(./'.+$('(((,,,)08*,(#+',,(*'*'+*')0.)''*')%)%'"&&%(*#&'%*'%%#)#()).>-)++,*&(,,,+))'(%$&--&+.)+**)*+,,-++*-./22+,(,(-)*'.-.*)(&%,(%$),'($%%)%&%&)"*#'$*&&%%#$#%%%$'$%''*)&(,%('%(+&'$$&"$#%%&%&$(%$'"($&%*$'$''$'$'(%(+%($&%%&%%%&($'-$(+%&$%&#%%%%$&%##$%%$#$%$#$#$$##$####$$$#$##$$#$%$"$&#%$#"%&#%#%#$$&%&$%%%%&&%&$'#
Many thanks for any advice.
Roxana
Comment
-
Hi Roxana,
We've been debugging the same error earlier this afternoon, also with nanopore data. The error is because FastQC is running out of memory due to the long reads (I presume).
You can allocate more memory for FastQC by increasing the number of threads - it gets 250MB memory per thread. Our data worked when we ran with four threads:
Code:fastqc -t 4 input.fastq
Comment
Latest Articles
Collapse
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 05-10-2024, 06:35 AM
|
0 responses
18 views
0 likes
|
Last Post
by seqadmin
05-10-2024, 06:35 AM
|
||
Started by seqadmin, 05-09-2024, 02:46 PM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
05-09-2024, 02:46 PM
|
||
Started by seqadmin, 05-07-2024, 06:57 AM
|
0 responses
19 views
0 likes
|
Last Post
by seqadmin
05-07-2024, 06:57 AM
|
||
Started by seqadmin, 05-06-2024, 07:17 AM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
05-06-2024, 07:17 AM
|
Comment