Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • STAR: Alignment reported with less matches than parameter --outFilterMatchNmin

    Hello,

    I am using STAR_2.3.0e.Linux_x86_64 to align only the first 25b of my paired-end reads, with the parameters:
    --outFilterMatchNmin 40

    --clip5pNbases 4 (there 4 random pairs before the PCR primer that I want to remove)

    --clip3pNbases 71 (in order to only keep the first 25 bases)

    --outSAMattributes All

    --outFilterMultimapNmax 3

    --outFilterMismatchNmax 5

    --outFilterMismatchNoverLmax 0.05

    --alignIntronMax 1

    --alignMatesGapMax 740

    I have cases like below where one mate of a pair is multiply mapped but with alignments containing a sum of matches that is less than 40, although I asked for a minimum of 40 matches using the parameter --outFilterMatchNmin.

    I don't understand why these alignments are recorded while they have less than 40 perfect matches (required using --outFilterMatchNmin).

    Any advice or guidance will be welcomed, thank you!

    Best,
    Anne

    HISEQ:97:H8U2HADXX:1:1101:3459:2064 355 CXCL3 328 3 4S25M71S = 428 111 AATTATGACAGGGTGGGGAACTGGAGGGTGGGGGGATTGAAATGCAAGCAATTAGTGGATCACTGTTAGGGTAAGGGAATGTATGTACACATCTATTTTT @C@DDFFFHHGGFACHEGIGGIGIHIII?DHIJJD8BDCDDCDDDDCCDDDDDCCDDDCDABDDDDDDDDD9ACCDDBDDDCCCD>B>CCCCDCDEEEED NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1

    HISEQ:97:H8U2HADXX:1:1101:3459:2064 403 CXCL3 428 3 81S11M8S = 328 -111 TTTGCTTTATAGGTTATTTTATTTTTATTTCTCTAATTCCTGGGTTTTTTTTTTTCTCTTAAAAAAAATATTTTTTATTTTCTTTTTTTTTATTGCCTTT #################################################################################################### NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
10 views
0 likes
Last Post seqadmin  
Working...
X