We encountered a non-standard non-IUPAC base in the provided reference '88'

[jdpr_100]

Hi,
Currently, I am working with bowtie2 and GATK to call SNPs on sugarcane. I am using Sbicolor_v2.1_255.fa, sorghum genome downloaded from phytozome, as reference.
java -Xms128m -jar GenomeAnalysisTK.jar -T UnifiedGenotyper -R Sbicolor_v2.1_255.fa -I input.sorted.bam -ploidy 8 -o input_gatk.vcf
I run into the following error.
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A USER ERROR has occurred (version 3.1-1-g07a4bf8):
##### ERROR
##### ERROR This means that one or more arguments or inputs in your command are incorrect.
##### ERROR The error message below tells you what is the problem.
##### ERROR
##### ERROR If the problem is an invalid argument, please check the online documentation guide
##### ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
##### ERROR
##### ERROR Visit our website and forum for extensive documentation and answers to
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
##### ERROR
##### ERROR MESSAGE: Bad input: We encountered a non-standard non-IUPAC base in the provided reference: '88'
##### ERROR ------------------------------------------------------------------------------------------

I hope someone can help me with these issues.
Thanks in advance.

[Richard Finney]

See : http://gatkforums.broadinstitute.org...d-reference-13

The file from ftp://ftp.jgi-psf.org/pub/compgen/ph...v2.1_255.fa.gz

appears to have "X"s in them ...

grep -n "X" Sbicolor_v2.1_255.fa
1653513:AGCCTCCCGTCCCCGATGTCTCCGACCACTGGTTAATATTCTTTXXXXXXXXXXXXXXXXXXXXXXXXXXCGGCGCTGGG
5189698:TCAATAATTTATCACTAAATCCTTTXXXXXXXXXXXXXXXXXXXXXAAATGTTATCATGTCTCAAAACGTCTGATGAATG
8205175:CTGTGTAGATAAGAXXXXXXXXXXXXXXXXXXXXXXXXXXCAAACAGGAAAGAGCGGCAGTGATTCAAGCAAAAACAAGT

IUPAC codes are here: https://en.wikipedia.org/wiki/Nucleic_acid_notation

I don't see X

[Brian Bushnell]

Apparently, the X means the sequence is masked for some reason, such as it was identified to be artificial (like vector sequence) and should not be in the assembly. I suggest you replace them with N.

[jdpr_100]

Thank you the reply. It is quite helpful.