Pindel, pindel2vcf, AD for REF allele always zero?

[BGould]

Hello fellow Pindel users,
I am using Pindel to detect structural variants and I find that in output VCF files, the allele depth (AD) for the reference allele for all variants in all samples is always zero. Has anyone else experienced this or know why this might occur?

My alignments (SAM files) were made with STAMPY.

I am running Pindel 0.2.5 with samtools 0.1.18 with these commands:

../pindel -f ~/AT_Reference/TAIR10_chr_all.fa -p infile_pindel.txt -c 1 -o Chr1pin -T 12

../pindel2vcf -p Chr1pin_D -r ~/AT_Reference/TAIR10_chr_all.fa -R TAIR10 -d 20140901 -e 3 -mc 6 -is 72 -m 2

I find that ALL the vcf lines in the output have support of 0 read depth for the reference allele. An example vcf line:

1 27916160 . CATAGTAAAAGCTTTGCGTTCAGACTCTGTCTAGATGATTCAGAAAACGCTGGAAATGAACCCACTTTGCTTGGCATTTTCAATTGGTGTTTATTGGGTT CTC . PASS END=27916259;HOMLEN=0;SVLEN=-99;SVTYPE=RPL;NTLEN=2 GT:AD 1/1:0,8 1/1:0,15 1/1:0,6 1/1:0,11 1/1:0,9 1/1:0,12 1/1:0,21 1/1:0,11 1/1:0,14 1/1:0,8 0/0:0,5 1/1:0,12 1/1:0,9 1/1:0,17 1/1:0,14 1/1:0,11 1/1:0,8 1/1:0,15 1/1:0,20 1/1:0,15 1/1:0,15 0/0:0,4 1/1:0,18 1/1:0,10 0/0:0,0 1/1:0,15 1/1:0,17 1/1:0,7 0/0:0,4 1/1:0,11 1/1:0,14 1/1:0,10

The pindel input file looks normal. Maybe there is a problem with the input STAMPY alignments?
Any advice would be much appreciated!

[KaiYe]

Hello fellow Pindel users,
I am using Pindel to detect structural variants and I find that in output VCF files, the allele depth (AD) for the reference allele for all variants in all samples is always zero. Has anyone else experienced this or know why this might occur?

My alignments (SAM files) were made with STAMPY.

I am running Pindel 0.2.5 with samtools 0.1.18 with these commands:

../pindel -f ~/AT_Reference/TAIR10_chr_all.fa -p infile_pindel.txt -c 1 -o Chr1pin -T 12

../pindel2vcf -p Chr1pin_D -r ~/AT_Reference/TAIR10_chr_all.fa -R TAIR10 -d 20140901 -e 3 -mc 6 -is 72 -m 2

I find that ALL the vcf lines in the output have support of 0 read depth for the reference allele. An example vcf line:

1 27916160 . CATAGTAAAAGCTTTGCGTTCAGACTCTGTCTAGATGATTCAGAAAACGCTGGAAATGAACCCACTTTGCTTGGCATTTTCAATTGGTGTTTATTGGGTT CTC . PASS END=27916259;HOMLEN=0;SVLEN=-99;SVTYPE=RPL;NTLEN=2 GT:AD 1/1:0,8 1/1:0,15 1/1:0,6 1/1:0,11 1/1:0,9 1/1:0,12 1/1:0,21 1/1:0,11 1/1:0,14 1/1:0,8 0/0:0,5 1/1:0,12 1/1:0,9 1/1:0,17 1/1:0,14 1/1:0,11 1/1:0,8 1/1:0,15 1/1:0,20 1/1:0,15 1/1:0,15 0/0:0,4 1/1:0,18 1/1:0,10 0/0:0,0 1/1:0,15 1/1:0,17 1/1:0,7 0/0:0,4 1/1:0,11 1/1:0,14 1/1:0,10

The pindel input file looks normal. Maybe there is a problem with the input STAMPY alignments?
Any advice would be much appreciated!

If you extract reads and then push them through Pindel, you will not get read count for ref supporting reads. you could use -i to see whether things work out.