[lyw1]

What does this mean:

zheng@zheng-XPS-8500:~/Desktop/bbmap/20140916ngs$ kmercountexact.sh in=Nfkb-05RNS160m_S5_L001_R1_001.fastq outk=Nfkb-05RNS160m_S5_L001_R1_001_counts16.txt mincount=3 k=16
java -ea -Xmx11527m -cp /home/zheng/Desktop/bbmap/current/ jgi.CountKmersExact in=Nfkb-05RNS160m_S5_L001_R1_001.fastq outk=Nfkb-05RNS160m_S5_L001_R1_001_counts16.txt mincount=3 k=16
Executing jgi.CountKmersExact [in=Nfkb-05RNS160m_S5_L001_R1_001.fastq, outk=Nfkb-05RNS160m_S5_L001_R1_001_counts16.txt, mincount=3, k=16]

ways=37
Initial:
Memory: free=187m, used=64m

Final:
Memory: free=473m, used=216m

Input: 780893 reads 21865004 bases.
Result: 0 reads (0.00%) 0 bases (0.00%)
Unique Kmers: 8523380
Exception in thread "main" java.lang.AssertionError: TGTGTATAAGAGACCA 3

at kmer.KmerNode.dumpKmersAsText(KmerNode.java:155)
at kmer.HashForest.dumpKmersAsText(HashForest.java:211)
at kmer.HashArray.dumpKmersAsText(HashArray.java:249)
at jgi.CountKmersExact.dumpKmersAsText(CountKmersExact.java:749)
at jgi.CountKmersExact.process(CountKmersExact.java:383)
at jgi.CountKmersExact.main(CountKmersExact.java:58)

[Brian Bushnell]

That's an error that you noted before. You can either keep running the curent version (but add -da to the command line) or grab the latest version here, in which it is fixed.

[lyw1]

Hi Brian,

I have a problem when I try to trim the adapter sequences.

zheng@zheng-XPS-8500:~/Desktop/bbmap/20141010ngs$ bbduk.sh -Xmx1g in=RNColonCancer_S9_L001_R1_001.fastq out=RNColonCancer_S9_L001_R1_001clean.fastq ktrim=r ref=nextera.fa.gz,truseq.fa.gz k=25 mink=12 hdist=1
java -ea -Xmx1g -cp /home/zheng/Desktop/bbmap/current/ jgi.BBDukF -Xmx1g in=RNColonCancer_S9_L001_R1_001.fastq out=RNColonCancer_S9_L001_R1_001clean.fastq ktrim=r ref=nextera.fa.gz,truseq.fa.gz k=25 mink=12 hdist=1
Executing jgi.BBDukF [-Xmx1g, in=RNColonCancer_S9_L001_R1_001.fastq, out=RNColonCancer_S9_L001_R1_001clean.fastq, ktrim=r, ref=nextera.fa.gz,truseq.fa.gz, k=25, mink=12, hdist=1]

maskMiddle was disabled because useShortKmers=true
Exception in thread "main" java.lang.RuntimeException: Can't read file 'nextera.fa.gz'
at align2.Tools.testInputFiles(Tools.java:65)
at jgi.BBDukF.<init>(BBDukF.java:610)
at jgi.BBDukF.main(BBDukF.java:66)

Thanks.

[Brian Bushnell]

When you specify "ref=nextera.fa.gz,truseq.fa.gz", you actually have to set the full path to the files or else put them in your working directory. After you unzip BBMap, they will be in /bbmap/resources/nextera.fa.gz and /bbmap/resources/truseq.fa.gz

-Brian

[lyw1]

Get rid of adapter sequence

Hi Brian,

In my case, I know the insert length for sequencing. It should be able to trim the adapter sequences by removing extra sequence. For example, my insert is 50 bp. I need to get rid of the sequences from the position of 51. Does BBmap have a similar function for this purpose? Thanks.

Zheng

[Brian Bushnell]

Hi Brian,

In my case, I know the insert length for sequencing. It should be able to trim the adapter sequences by removing extra sequence. For example, my insert is 50 bp. I need to get rid of the sequences from the position of 51. Does BBmap have a similar function for this purpose? Thanks.

Zheng

Yes. If the insert size is always exactly 50:

bbduk.sh -Xmx1g in=reads.fq out=trimmed.fq forcetrimright=49

[lyw1]

Great.

Thanks. I like it.

[lyw1]

Hi Brian,

If I add 70 bp inserts between sequencing adapters and run 75 cycles sequencing from both sides, I should be able to get 50 bp at 5' side from read 1 sequence according to your instruction. Is it possible for me get these 50 bp from read 2 sequence (should be from 21 bp to 70 bp of sequencing result)? Is it possible for me to get the sequence in the middle (from position 25 to 65)? thanks,

Zheng

[Brian Bushnell]

Zheng,

I would expect that for 70bp inserts, paired-ended, using 75 cycles, the bases at position 20-69 in read 2 would correspond to the the bases at position 0-49 in read 1 (these positions are all 0-based). The command to get them would be

The command for that would be:

bbduk.sh -Xmx1g in=reads.fq out=trimmed.fq ftr=69 ftl=20

where ftl and ftr stand for "forcetrimright" and "forcetrimleft".

[lyw1]

Got it. thanks.

[lyw1]

Hi Brian,

I found some sequences that don't have a known leading sequence. Those sequences are amplified in PCR but they are not my target sequence. Is it possible for me to pick all the sequences that include same leading sequences (at 5' end or 3' end)? Then I can remove the leading sequence to get my target sequences. Thanks,

Zheng

[Brian Bushnell]

Hi Brian,

I found some sequences that don't have a known leading sequence. Those sequences are amplified in PCR but they are not my target sequence. Is it possible for me to pick all the sequences that include same leading sequences (at 5' end or 3' end)? Then I can remove the leading sequence to get my target sequences. Thanks,

Zheng

Zheng,

Yes, that is possible, if you know the sequence. You can use BBDuk for filtering a specific sequence at the beginning of the read like this:

bbduk.sh -Xmx1g in=reads.fq outm=matched.fq outu=unmatched.fq restrictleft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA

In this case, all reads starting with "AAAAACCCCCTTTTTGGGGGAAAAA" will end up in "matched.fq" and all other reads will end up in "unmatched.fq". Specifically, the command means "look for 25-mers in the leftmost 25 bp of the read", which will require an exact prefix match, though you can relax that if you want.

So you could bin all the reads with your known sequence, then look at the remaining reads to see what they have in common. You can do the same thing with the tail of the read using "restrictright" instead, though you can't use both restrictions at the same time.

[lyw1]

Thanks, Brian. That is great.

Zheng

[lyw1]

Hi Brian,

There is bug here,

Exception in thread "main" java.lang.RuntimeException: Unknown parameter restrictleft=10
at jgi.BBDukF.<init>(BBDukF.java:427)
at jgi.BBDukF.main(BBDukF.java:66)

[Brian Bushnell]

Zheng,

Are you using the latest version (34.19) of BBTools? I added "restrictleft" and "restrictright" only a few weeks ago, so an old version won't support those flags...