Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • error running STAR

    I am using STAR to map my paired end rna seq data. I keep running into the following error msg.
    EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >
    This was my command line:
    -bash-3.2$ /pathToStarDir/ STAR --genomeDir /pathToGenome/ --readFilesCommand zcat --readFilesIn /pathToFile/587352_1_1.fastq.gz pathToFile/587352_1_2.fastq.gz --runThreadN 3

    When I zless my .fastq.gz file to check the format of the file, the first few lines looks like this:
    @HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
    GCTGTATCTCTCAGGATTATCACTGATCACACATCCAACCAGTGCCAGCCAAAAGGATGCCCTGAGGCAAAGGGT
    +HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
    bbd_dee`dcdfefffffeffffffaeeeefdfffffefffeeefeffffffefcffcefffeffadfedbbTcU
    @HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
    GGCCATCTGATCTATAAATGCGGTGGCATCGACAAAAGAACCATTGAAAAATTTGAGAAGGAGGCTGCTGAGATG
    +HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
    gecgggggggffgdggfgggfffgddedfbecbcdadfadeg^eaedda^g`cdbdggdgdV^a`X`_``W]V]c

    Has anyone ran into similar problems before? Is it a file problem or there was mistakes in my command ?

    Thanks for the help in advance.

    J.Z

  • #2
    Can you try Brian's repair.sh tool to see if you can fix problems with your fastq files: http://seqanswers.com/forums/showpos...0&postcount=45 I am not sure if it will catch malformed ID headers.

    Alternatively fastqValidator can be used to see if you do have a problem with formatting: http://genome.sph.umich.edu/wiki/FastQValidator

    Comment


    • #3
      I don't see a problem with the first 8 lines, at least. And yes, repair.sh requires correctly-formatted fastq headers; it's only for fixing broken pair ordering. I'm not familiar with how STAR deals with gzipped files, but perhaps you could try decompressing it first?

      Comment

      Latest Articles

      Collapse

      • seqadmin
        The Impact of AI in Genomic Medicine
        by seqadmin



        Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
        02-26-2024, 02:07 PM
      • seqadmin
        Multiomics Techniques Advancing Disease Research
        by seqadmin


        New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

        A major leap in the field has
        ...
        02-08-2024, 06:33 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 02-28-2024, 06:12 AM
      0 responses
      28 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-23-2024, 04:11 PM
      0 responses
      74 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-21-2024, 08:52 AM
      0 responses
      82 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-20-2024, 08:57 AM
      0 responses
      69 views
      0 likes
      Last Post seqadmin  
      Working...
      X