error running STAR

[JJZ]

I am using STAR to map my paired end rna seq data. I keep running into the following error msg.
EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >
This was my command line:
-bash-3.2$ /pathToStarDir/ STAR --genomeDir /pathToGenome/ --readFilesCommand zcat --readFilesIn /pathToFile/587352_1_1.fastq.gz pathToFile/587352_1_2.fastq.gz --runThreadN 3

When I zless my .fastq.gz file to check the format of the file, the first few lines looks like this:
@HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
GCTGTATCTCTCAGGATTATCACTGATCACACATCCAACCAGTGCCAGCCAAAAGGATGCCCTGAGGCAAAGGGT
+HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
bbd_dee`dcdfefffffeffffffaeeeefdfffffefffeeefeffffffefcffcefffeffadfedbbTcU
@HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
GGCCATCTGATCTATAAATGCGGTGGCATCGACAAAAGAACCATTGAAAAATTTGAGAAGGAGGCTGCTGAGATG
+HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
gecgggggggffgdggfgggfffgddedfbecbcdadfadeg^eaedda^g`cdbdggdgdV^a`X`_``W]V]c

Has anyone ran into similar problems before? Is it a file problem or there was mistakes in my command ?

Thanks for the help in advance.

J.Z

[GenoMax]

Can you try Brian's repair.sh tool to see if you can fix problems with your fastq files: http://seqanswers.com/forums/showpos...0&postcount=45 I am not sure if it will catch malformed ID headers.

Alternatively fastqValidator can be used to see if you do have a problem with formatting: http://genome.sph.umich.edu/wiki/FastQValidator

[Brian Bushnell]

I don't see a problem with the first 8 lines, at least. And yes, repair.sh requires correctly-formatted fastq headers; it's only for fixing broken pair ordering. I'm not familiar with how STAR deals with gzipped files, but perhaps you could try decompressing it first?