Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • sam flag 97 and 145


    After alignment, I got reads in the sam format with flag 97 and 145.
    flag 97:
    the read is paired in sequencing;
    strand of the mate reverse;
    the read is the first read in a pair;

    flag 145:
    the read is paired in sequencing;
    strand of the query;
    the read is the second read in a pair;

    These reads are not mapped in a proper pair but both query and mate are mapped. how to explain this? could you give me an example?


  • #2
    They might be mapping to different contigs? What are the full SAM lines for these two reads?


    • #3
      The reads are looking like the following. I only have one reference sequence.

      ENST000004134650_104_988_445_609_200# 97 ENSG00000141510 13261 37 36M = 14182 957 CGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTC 22222
      2222222222222222222222222222222 XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36

      ENST000004134650_104_988_445_609_200# 145 ENSG00000141510 14182 37 36M = 13261 -957 GCGGCCACATCCTCGACGACCACGTCCCCGGTGCCC 22222
      2222222222222222222222222222222 XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36


      • #4
        anybody help?


        • #5
          First read, 97 == 1 + 32 + 64 == 0x1 + 0x20 + 0x40

          0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
          0x0020 strand of the mate (0 for forward; 1 for reverse strand)
          0x0040 the read is the first read in a pair

          Second read, 145 == 1 + 16 + 128 == 0x1 + 0x10 + 0x80

          0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
          0x0010 strand of the query (0 for forward; 1 for reverse strand)
          0x0080 the read is the second read in a pair

          So first read (flag 97) is on the forward strand (since it does not have 0x10 set), second read (flag 145) is on the reverse strand (since it does have 0x10 set).
          Last edited by maubp; 05-14-2010, 01:31 PM. Reason: corrected forward/reverse as discussed in next two posts


          • #6
            I think it is the other way round:
            the first read (97) is on the forward strand, since the strand of the mate is 1 (reverse);
            the second read is on the reverse strand.

            and in both cases (97,145)
            0x0002 the read is mapped in a proper pair =0
            0x0004 the query sequence itself is unmapped=0 (0 means it is mapped ???)
            0x0008 the mate is unmapped=0 (0 means it is mapped ???)
            This means both of them are mapped? but not proper?
            Last edited by hollandorange; 05-14-2010, 01:18 PM.


            • #7
              Originally posted by hollandorange View Post
              I think it is the other way round:
              the first read (97) is on the forward strand, since the strand of the mate is 1 (reverse);
              the second read is on the reverse strand.
              Yes - I had it right the first time, but flipped in back in a hurry before leaving the computer


              • #8
                I had a detail look at the samtool manu. I found, for these reads, the inferred insert size is very large like 957. but in my setting, the insertsize_mean is 200 and std is 20.

                is it the reason that they are mapped, but their mapped position is too far away and then samtool report not proper mapped?


                • #9
                  Originally posted by hollandorange View Post
                  I had a detail look at the samtool manu. I found, for these reads, the inferred insert size is very large like 957. but in my setting, the insertsize_mean is 200 and std is 20.

                  is it the reason that they are mapped, but their mapped position is too far away and then samtool report not proper mapped?
                  The flags are set by the aligner, not samtools, so checkout the aligner's documentation. Check out the following to help you digest individual tags:

                  Also, you can use the "-X" option in "samtools view" to convert the flag field to a string format.


                  Latest Articles


                  • seqadmin
                    Essential Discoveries and Tools in Epitranscriptomics
                    by seqadmin

                    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                    04-22-2024, 07:01 AM
                  • seqadmin
                    Current Approaches to Protein Sequencing
                    by seqadmin

                    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                    04-04-2024, 04:25 PM





                  Topics Statistics Last Post
                  Started by seqadmin, Today, 08:47 AM
                  0 responses
                  Last Post seqadmin  
                  Started by seqadmin, 04-11-2024, 12:08 PM
                  0 responses
                  Last Post seqadmin  
                  Started by seqadmin, 04-10-2024, 10:19 PM
                  0 responses
                  Last Post seqadmin  
                  Started by seqadmin, 04-10-2024, 09:21 AM
                  0 responses
                  Last Post seqadmin  