Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Cannot understand Tophat output... Help!

    Hello All,

    I built an index using Drosophila genes giving the bowtie-build command. This worked just fine and I got the six files. Then I ran Tophat from the same folder using the following command

    tophat --solexa1.3-quals -p 4 GeneIndex path_to_reads

    My reads are unpaired. The output says that the Tophat run was OK. There is nothing in the error file. However in the tophat_out folder, I get the following files and directories.

    File: GeneIndex.fa
    File: left_kept_reads.fq
    Folders: log, tmp

    Within these folders I do not find the files accepted.sam and junctions.bed. What am I doing wrong. Any suggestions?

    Thank you
    Abhijit

  • #2
    Hello,

    Tophat seems to have run properly, the error output has no warnings. However the accepted.sam file shows no hits. The junctions.bed file is 1.3 MB. Anyone faced a similar problem?

    Thanks
    Abhijit

    Comment


    • #3
      Hello,

      Following up on this, I wanted to know if indexing of all genes is possible or not in the first place. My genes.fasta file looks something like this.

      Code:
      >FBgn0034974 type=gene; loc=2R:19969255..19973683; ID=FBgn0034974; name=CG16786; dbxref=FlyBase:FBgn0034974,FlyBase:FBan0016786,FlyBase_Annotation_IDs:CG16786,GB:BI363616,GB:BT001664,GB_protein:AAN71419,GB_protein:AAF47161,GB_protein:AAM68305,UniProt/TrEMBL:Q7JRF0,INTERPRO:IPR011071,EntrezGene:37856,BIOGRID:63435,DroID:FBgn0034974,DRSC:FBgn0034974,FlyAtlas:CG16786-RA,flyexpress:FBgn0034974,FlyMine:FBgn0034974,GenomeRNAi_gene:37856,modMine:FBgn0034974; derived_computed_cyto=60B8-60B9%3B Limits computationally determined from genome sequence between @P{lacW}Phm<up>k07623</up>@%26@P{lacW}tsr<up>k05633</up>@ and @P{EP}EP503@; gbunit=AE013599; MD5=4a28df05c5f7a49b8fd75a28e3b5759e; length=4429; release=r5.27; species=Dmel; 
      CGGATTCGGATTCAGATTCACATTCAGATTCAGATACGTTCGGTTTGGGA
      TTCGGATTCATTCGTTGCCACTCCAGCTCTATGCTCCGCGTTGGACCCAC
      CGATAGCTTGGCTTTCTGCTACAGTTTCATAATTGTCTCGGCCAGCAGCA
      GCGGAGTTCATGATTTCGCTCGGAATATGTTTTAGCCAGATCAGTGCTTG
      GAAAATGCACTTTTGAGCGTGTACGTGTATGTGGCAAGTAGCTGGCGAAC
      GTGAATGAAAACATGAGCTGCCACTGAACGAAACCCACTCTCGAGCTGGA
      AGTGCAAGTGAGTTATCCCGCGGAAGAAAAGAAACTGAATTGATTACCAT
      TACCATTCGCGGAGTAGCAGTCTCGGAATTAAATACCAACGACCCAGACA
      ATACCGAGCCCAGTTCCAAGCTGGAGGCTCAAGCCTTTCTCTATTCAATG
      Do I need to re-import a modified fasta file which has a shorter head information? There seems to be a lot of characters in the header which I cannot understand.

      thanks
      Abhijit

      Comment


      • #4
        Hi,

        You should build a new bowtie index of the Drosophila genome and not of the individual genes as TopHat is designed to align RNA-seq reads against a full genome. This might explain the behaviour of TopHat, although it should have aligned some reads after all. Perhaps the characters in the fasta headers are causing trouble or there are too many contigs for TopHat to handle well.

        Comment


        • #5
          Hi Thomas,

          I ran Tophat on the chromosomes and it works wonderfully. I think the fasta header might be the one to blame, since there are characters such as %@><{} etc. It appeared to me as some sort of construct info. Anyways I removed everything except the name of the sequence, and am building the gene index again. Lets see. However, the gene file that I am building the index from is 85 MB in size containing 14964 genes. You think this may cause a problem? Thanks for your help.

          Abhijit

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Best Practices for Single-Cell Sequencing Analysis
            by seqadmin



            While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
            06-06-2024, 07:15 AM
          • seqadmin
            Latest Developments in Precision Medicine
            by seqadmin



            Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

            Somatic Genomics
            “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
            05-24-2024, 01:16 PM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 06-21-2024, 07:49 AM
          0 responses
          14 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-20-2024, 07:23 AM
          0 responses
          14 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-17-2024, 06:54 AM
          0 responses
          16 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-14-2024, 07:24 AM
          0 responses
          25 views
          0 likes
          Last Post seqadmin  
          Working...
          X