Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Broadie
    Member
    • Oct 2009
    • 15

    Batch Oligo Selection Script

    Hello,

    I've written a script that I'd like to share for batch primer picking for gaps. As many of you know with bacterial finishing we have to close many more gaps (sometimes hundreds) and manually selecting and validating primers can be time consuming. BOSS should take a lot of the pain out of that. Typically, it takes me 5 hours to select and validate primers manually 100 gaps, but with BOSS, it takes 5 minutes. I hope you will give it a try and let me know if you have any feedback. Please see the readme below for details.


    download at:
    Download Batch Oligo Selection Script (BOSS) for free. A batch primer selection program designed to select PCR oligos for gap closure for assemblies containing a large number of gaps. BOSS will select oligos for gap closure of both contig and scaffold gaps.




    ###Batch Oligo Selection Script(BOSS) V2.2 README###

    A) DESCRIPTION

    Batch Oligo Selection Script V2.2 (BOSS 2.2) is a program that selects primers using a heuristic algorithm. Two template primers an
    d sequencing primers are selected and evaluated against user specified quality settings. The algorithm continuously slides
    a 500 base window away from the gap edgeuntil the users quality threshold are met. The script outputs a number of files
    to assist the user in the finishing process:
    * A hits file indicates the uniqueness of each primer in a primet set.
    * A stats file provides size and positional information for each primer in a primer set.
    * A csv file is provided containing the actual primers selected for a primer set.
    * An ace file is created identical to the input ace file but containing tags for all primers selected.
    In addition, a set of five files are generated for each gap evaluated (use -log option to prevent them from being removed).
    These are a primer 3 input file, primer 3 output file, a fasta file, a blast results file, and a score file that indicates how BOSS
    evaluated the BLAST results in the blast file. Please see below for options and usage.

    B) DEPENDENCIES

    BOSS depends on Primer3 and Blast, and requires one output file from consed. If you do need to download and install either, please v
    isit the following links:

    Primer3
    Download Primer3 - PCR primer design tool for free. Design PCR primers from DNA sequence. Widely used (190k Google hits for "primer3").


    Blast


    Prior to using the program, you must save an info.txt file using
    Consed for the ace file assembly you wish to select oligos. Do
    this by opening the ace file in consed and selecting Info>Show Maps of
    Contigs In Scaffolds>Save to File>OK.

    C) INSTALLATION INSTRUCTIONS

    1) Extract the boss.tar.gz archive file to the desired location.
    2) Open boss.pl in a text editor such as xemacs.
    3) Edit line 43 between quotation marks to your path for the primer3core installation. Leave the last "/" off.
    For example, if primer3 is installed in /production/tools/primer3, line 43 should read:

    my $blast_path="/production/tools/primer3";
    4) Edit line 44 between quotation marks to your path for the blastall installation. Leave the last "/" off.
    For example, if blastall is installed in /production/tools/blast/blast-2.2.14/bin/blastall, line 44 should read:

    my $blast_path="/production/tools/blast/blast-2.2.14/bin";

    5) Save the file and exit.

    6) If you know how many cores the linux machine that blast is running on has, change the "4" in line 45 to that number. If you do no
    t know,
    you can try changing this number to 1 if you have any problems.

    D) BASIC HELP

    DESCRIPTION
    Batch Oligo Selection Script V2.2 (BOSS 2.2) is a program that selects primers using a heuristic algorithm. One or two template prim
    ers and sequencing primersare selected and evaluated against user specified quality settings. The algorithm continuously slides
    a 500 base window away from the gap edgeuntil the users quality threshold are met. The script outputs a number of files
    to assist the user in the finishing process:
    * A hits file indicates the uniqueness of each primer in a primet set.
    * A stats file provides size and positional information for each primer in a primer set.
    * A csv file is provided containing the actual primers selected for a primer set.
    * An ace file is created identical to the input ace file but containing tags for all primers selected.
    In addition, a set of five files are generated for each gap evaluated (use -log option to prevent them from being removed).
    These are a primer 3 input file, primer 3 output file, a fasta file, a blast results file, and a score file that indicates how BOSS
    evaluated the BLAST results in the blast file. Please see below for options and usage.
    -----------
    OPTIONS
    The following options are available. Options with default settings will be set to internal defaults or config file settings
    unless explicity specified. Required Options are indicated as so and script will not run without them.

    -a: Designate input ace File(required).
    -g: Activate gap identifier column in csv file.
    -o Designate a custom ace output name (default is bpp_output.ace).
    -i: Designate info.txt scaffold information file(required).
    -log: Write processes to a log file named bpp.log.
    -f: Designates numeral for first primer number(Default=1) for oligo tags
    -t Activate additional order for each gap with template as sequencing primer.
    -r: Designate minimum acceptable primer set ranking(default=2). See below for details.
    -min: Designate minimum acceptable primer length (default=18).
    -opt: Designate optimal acceptable primer length (default=25).
    -max: Designate maximum acceptable primer length (default=28).
    -tmin: Designate minimum acceptable melting temp (default=53).
    -topt: Designate optimal acceptable melting temp (default=55).
    -tmax: Designate maximum acceptable melting temp (default=60).
    -gcmin: Designate minimum acceptable percent gc (default=20).
    -gcmax: Designate maximum acceptable percent gc (default=80).
    -gcend: Desigmate maximum allowable Gs and Cs in last 5 based of 3'end(default=2).
    -clamp: Designate GC clamp(default=0).
    -ex: Designate minimum allowable contig size to allow for primer selection(default=2000).
    -polyx: Designmate maximum allowable length of mononucleotide run in primer(default=3).
    -------
    USAGE
    boss.pl <PROJECT> -a <INPUT ACE FILE> -i <INPUT INFO.TXT FILE> -s <SUBCLONE> <OPTIONS: -r -min -max etc..>

    -----
    PRIMER SET RANK DEFINITIONS
    The primer set ranking option (-r) defines what primer sets are accepted and which are rejected. They are as follows from most strin
    gent to least:
    4 (Excellent) Template and sequencing primers are ALL unique.
    3 (Good) Template primers are unique, at least one sequencing primer is not.
    2 (Fair) One Template primer is unique, sequencing primers may or may not be unique.
    1 (Poor) Neither Template prime is unique. Use this rating for the -r option is not recommended!

    In addition, you will sometimes see in the bpp.hits file a ranking called "Forced Selection."
    This indicates that the program could not find a primer set that meets at least "Fair" criteria and therefore defaults to the first
    primer set selected for the gap.
    See the bpp.hits file for examples of these ratings applied to primer sets.

    E) UNDERSTANDING OUTPUT

    CSV output
    BOSS outputs 3 CSV files. The first part of the name will be the project you designated when launching the script. This will be foll
    owed by _gaps.csv, _bubble.csv, or _combo.csv depending on which file you are looking at. The gaps.csv file contains one PCR reactio
    n per line with 2 template oligos and 2 sequencing oligos. An assembly with 3 gaps will have 3 reactions (or 6 if you use the -t opt
    ion) will look like this:

    project,subcloneName,oligoOneSequence,oligoTwoSequence,seqOligoOneSequence,seqOligoTwoSequence
    P12345,S1234,GAATTTCTTTCAAACCGATGT,TGCATATCGTAAATAAACGTAAATA,GCCGAACACGCTGTCTTT,ATTTCATCATTCCCACAAGAT
    P12345,S1234,CCGTTATGCTATGGGTTATC,GAAGACGAAAGACGTATTAATAGAA,CAAGCCTAATGCAGTCAATATAC,GAACTGAATAAATTAAGTTCTTTGG
    P12345,S1234,TTTGTCTTTGATTTCTTTGTTTAC,ATTTGCATAGAAACACCACCTA,GTGATTCAGGTAATACTCGGTAAC,AAATTTCATCATTCCCACAA

    Each line is a reaction for a project whos designation is P12345, on a subclone that is designated S1234, and consists of four oligo
    s. The first two are the left and right template oligos used to generate the PCR template, and the last two are the primers existing
    between the two template primers that will be used in the sequencing reaction.

    The bubble.csv file will contain a selection of one template and sequencing primer for each scaffold edge in the assembly. This is u
    seful for anchored or bubble PCR applications and will look like so:

    pcrType,pcrSubtype,chemistry,project,subcloneName,oligoOne,seqOligoSequence
    J38842,G1459,AAACCATAGCGGATTAACG,GGGAATCCAGGACGTAAA
    J38842,G1459,GTACCGGCTCGGATTCTT,GGTTGTTGTGTCCTTGAAAC
    J38842,G1459,CGTGAACCTTGCCAACAA,CGATACAAAGTCGATTGAAA

    The combo.csv will contain scaffold edge to scaffold edge primer pairings in every possible combination. So if you have two scaffold
    s (4 scaffold edges), BOSS generates a reaction for each possible scaffold-to-scaffold relationship. combo.csv output looks like thi
    s:

    project,subcloneName,oligoOneSequence,oligoTwoSequence,seqOligoOneSequence,seqOligoTwoSequence
    J38842,G1459,GTCCAGTATATCTGGGATAGCTTAT,CGTGAACCTTGCCAACAA,GAAAGAAGTACAGAAAGAAGTACAGA,CGATACAAAGTCGATTGAAA
    J38842,G1459,GTCCAGTATATCTGGGATAGCTTAT,GTCAGCGGCACATTCTTT,GAAAGAAGTACAGAAAGAAGTACAGA,AAGTTCGTATTGGAAATCATTC
    J38842,G1459,GTCCAGTATATCTGGGATAGCTTAT,TACAACCTTTGCTCCATCA,GAAAGAAGTACAGAAAGAAGTACAGA,TCAGGTAGCCTTATCACGTT

    You will notice that the left template and sequencing primer is the same in all three reactions, but the right are not. This is BOSS
    pairing one particular scaffold edge with three other scaffold edges.

    Analysis output

    In addition to the csv files, boss outputs several files to assist in analysis or validation of the primers. These are bbp.hits,bpp.
    hits.se,bpp.stats and bpp.stats.se. The versions with the .se extension are the same as those without except that they are pertinent
    to the scaffold edge primers used in the bubble.csv and combo.csv files.

    The bpp.hits file is the analysis of each 4 primer set selected for each gap in the assembly. The file looks like this:

    Gap Identifier T1 Hits T2 Hits S1 Hits S2 Hits Set Strength
    contig00013_contig00014 4 1 1 1 Fair
    contig00014_contig00015 1 1 1 1 Excellent
    contig00015_contig00016 1 1 1 1 Excellent

    Gap Identifier indicates the gap between the contigs to the left and right of the underscore. T1 Hits indicates how many "perfect" b
    last hits were found that matched the left template oligo, T2 Hits for the right template oligo, S1 Hits for the left sequencing oli
    go, and S2 Hits for the right sequencing oligo. Set Strength is a qualitative rating of the primer set. See Basic Help in section D
    for details. Thus, this file gives you an idea of how unique the primers selected are with respect to the entire assembly.

    The bpp.stats file gives coordinate information regarding the primers selected, and looks like this:

    Gap Identifier T1-S T1-E T2-S T2-E S1-S S1-E S1-DTE S1-L S2-S S2-E S2-L Template Size
    contig00015_contig00016 67703 67721 400 418 67825 67847 351 Y 207 230 Y 412
    contig00016_contig00017 2444 2463 396 417 2573 2592 349 Y 200 218 Y 407
    contig00017_contig00018 55441 55464 367 392 55503 55527 407 Y 228 247 Y 377

    The first column identifies the gap as in the bpp.hits file. Columns T1-S,T2-S,S1-S,S2-S give the starting coordinates of each oligo
    in its respective contig.T1-E,T2-E,S1-E,S2-E gives the ending coordinates of each oligo in its respective contig. S1-DTE indicates
    the distance to the gap edge for the left sequencing primer. S2-S provides the same information for the right sequencing primer. S1-
    L and S2-L are just confirmations that the sequencing primers are logically placed, that is, within the bounds of the template prime
    rs. Template size indicates the distance between T1-S and T2-E, not including the missing sequence in the gap.

    F) HELP!
    If you need help with BOSS, please contact the author at [email protected]. Thank you for downloading BOSS V2.2.

Latest Articles

Collapse

  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 11:41 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-20-2026, 11:10 AM
0 responses
23 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
36 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
45 views
0 reactions
Last Post SEQadmin2  
Working...