I'm trying to get the data for the Human and Mouse 12 and 23 Recomination Signal Sequences (RSS), to run a classification algorithm on it. I'm not a biologist, so I apologise in advance for my misunderstandings and confusion.
A version of the data is available here, but I thought I would try to get it from www.imgt.org, if possible. There is also another slightly different version available for the mouse here.
I'm trying to follow the instructions at IMGT-FAQ to obtain Recombination Signal Sequences for the mouse.
Here is what I have selected at the search page:
I'm not clear what "Locus", "Main locus", and "IGMT group" mean here exactly. Specifically, what is the difference between "Locus" and "Main locus"?
I think, but am not sure, that IGHV corresponds to V genes in the Immunoglobulin heavy locus (IGH@) on chromosome 14, where locus here denotes collections of genes. Clarifications and corrections appreciated.
I would have expected that the IGH locus would correspond to "IMGT group" entries like "IGHJ, IGHV" etc, and the IGK locus would correspond to IMGT group entries like "IGK, IGKJ, IGKV", but no matter what I select for Locus, it does not change the possible entries for "IMGT group".
Running the search gives
Number of resulting genes : 218 Number of resulting alleles : 350
As instructed, I went to the bottom, selected "Select all genes", clicked on "Choose label(s) for extraction", and selected "V-RS".
I got
Number of results=98
The first few results were
Ok, now I'm confused. The lengths of the RSS should be 28 or 39. but I counted lengths of 4,7, 31, 38, and 39. Are the results here not supposed to contain the 12 and 23 RSS?
So, I must be misunderstanding things here. Possibly many things. Any explanations and clarifications are appreciated.
A version of the data is available here, but I thought I would try to get it from www.imgt.org, if possible. There is also another slightly different version available for the mouse here.
I'm trying to follow the instructions at IMGT-FAQ to obtain Recombination Signal Sequences for the mouse.
Here is what I have selected at the search page:
Code:
Identification: Species : Mus Musculus GeneType: any Functionality: functional MolecularComponent: any Clone name: <blank> IMGT group: IGHV IMGT subgroup: any IMGT gene: <blank>
I think, but am not sure, that IGHV corresponds to V genes in the Immunoglobulin heavy locus (IGH@) on chromosome 14, where locus here denotes collections of genes. Clarifications and corrections appreciated.
I would have expected that the IGH locus would correspond to "IMGT group" entries like "IGHJ, IGHV" etc, and the IGK locus would correspond to IMGT group entries like "IGK, IGKJ, IGKV", but no matter what I select for Locus, it does not change the possible entries for "IMGT group".
Running the search gives
Number of resulting genes : 218 Number of resulting alleles : 350
As instructed, I went to the bottom, selected "Select all genes", clicked on "Choose label(s) for extraction", and selected "V-RS".
I got
Number of results=98
The first few results were
Code:
>X02459|IGHV1-4*02|Mus musculus_BALB/c|F|V-RS|395..432|38 nt|NR| | | | |38+0=38| | | cacagtggtgcaaccacatcccgactgtgtcagaaacc >X02064|IGHV1-54*02|Mus musculus|F|V-RS|295..332|38 nt|NR| | | | |38+0=38| | | cacagtgttgcaaccacatcctgagtgtgtcagaaatc >M34978|IGHV1-58*02|Mus musculus_A/J|P|V-RS|554..560|7 nt|NR| | | | |7+0=7|partial in 3'| | cacagtg
So, I must be misunderstanding things here. Possibly many things. Any explanations and clarifications are appreciated.