Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • bioinfosm
    Senior Member
    • Jan 2008
    • 483

    #16
    this is very useful miRNA discussion. I have some experience using Illumina's flicker tool.. but not much beyond that. mirTools did not work as well as expected and has its shortcomings..

    my hypothesis is

    fastq -> adapter trimming -> alignment (novoalign?) (to human genome or reference of mirBase?) -> expression

    feel free to add to this..
    --
    bioinfosm

    Comment

    • quicksand21
      Junior Member
      • May 2010
      • 6

      #17
      Hi all,

      I'm glad to see my post has received some excellent feedback. Since posting, I have since gone on to developing a pipeline which utilizes a variety of tools. If you're looking for a nice, self-contained method for analyzing small-RNA transcriptome sequencing data, I have been pleased with using miRanalyzer, miRexpress, miRtools, and DSAP. These tools are web-based except for miRexpress, which is command-line. They all address issues of taking reads, adapter trimming, filtering, alignment, annotations, expression profiling, and some utilize different strategies for identifying novel miRNA candidates.

      I have also (and am still in the process) of developing an in-house pipeline for such analysis. The basic steps are basically what bioinfosm diagrammed:

      fastq --> remove redundancy --> adapter trimming --> remove redundancy again --> filter out low CN --> filter out reads that align to the wrong organism --> alignment (bowtie, maq, novoalign) to the appropriate genome or miRbase hairpins or to known non-coding RNA, snoRNA, etc. --> annotate the aligned reads --> use the reads that aligned and their associated copy numbers to derive expression profiles for the miRNA. I've also started to implement some in-house novel, candidate miRNA algorithms.

      A paper I found extremely useful in addition to the great responses from this forum:

      http://bib.oxfordjournals.org/conten...bp019.abstract

      The Authors do a nice job walking readers through the steps of analyzing sequencing data for small RNAs.

      Comment

      • mitchelS
        Junior Member
        • Oct 2008
        • 4

        #18
        miRNA analysis

        Hi All,

        I'm attaching our recent publication which may be of help for those like myself that do not have a bioinformatics background



        We used utilized miRanalyzer as it easily found which of the known mir's where present in mirBase at the time (early 2009 I think) but more importantly it mapped, after removing unwanted reads, back to the genome to predict novel mir's. This prediction is still of course a prediction but after filtering with another program (CID-miRNA), this reduced the list of candidates considerably...many of these have since been deposited in mirBase.

        anyway I hope this helps,

        cheers,

        M.

        Comment

        • dnusol
          Senior Member
          • Jul 2009
          • 136

          #19
          Hi Bioinfosm,
          I read about Flicker utility but have not found much about it. Where can it be obtained? How does it compare to FASTX toolkit?

          Comment

          • bioinfosm
            Senior Member
            • Jan 2008
            • 483

            #20
            flicker is from Illumina's ICOM download. How are you comparing it to fastx, which I believe is a QC reporting toolkit!

            @mitchelS, thanks for sharing the paper. I could not get their perl script to work but will code up my own and try out their tool!

            @quicksand21, thanks for a more inclusive flow-gram!
            --
            bioinfosm

            Comment

            • dnusol
              Senior Member
              • Jul 2009
              • 136

              #21
              FASTX toolkit has also utilities for adapter removal

              Edit: by the way, has anyone seen a TC end in a large portion of the small RNA sequences after removing Illumina's adapter? FASTX_clipper seems to have removed the adapter but I end up with a TC pair as the example

              original read:
              TGACTCGGAGCGAAGTGACGGATCTCGTATGCCGTCTT
              read after trimming
              TGACTCGGAGCGAAGTGACGGATC

              best

              Dave

              Edit:
              I can answer myself, we were using the new illumina adapters without notice, so actually the ATC tail is also part of the new adapter. This was also mentioned in another post.
              Last edited by dnusol; 10-07-2010, 05:45 AM.

              Comment

              • konika
                Member
                • Sep 2010
                • 14

                #22
                Hi,
                I have miRNA data and have aligned the nonredundant sequences for each of 3 samples to each of 5 chromosomes in Arabidopsis.
                question -is it correct ? or should I use all sequences to map (redundant miRNA sequences)
                I have used the bowtie files (sam file)->bam-> sorted->indexed
                and visualize them on IGV ,And I see many reads align at almost same locations in chromosome in the 3 samples.
                I want to know how important is this, and how can I find the top places (gene locations) where maximum number of these short reads map.
                are there any softwares for statistical analysis of such data.
                Konika

                Comment

                • Jayu
                  Member
                  • Mar 2011
                  • 14

                  #23
                  Hi,

                  I am trying to use flicker for miRNA illumina data which i downloaded from SRA.

                  I executed following command
                  perl ~/scripts/flicker.pl --fastq=project_illu_rice/SRR062265.fastq --casava=/usr/local --contam=./AbundantSequences --genomic=./genome/ --mir=miRBase/mature.fa --precursor=miRBase/hairpin.fa --tagSum --summary --adaptor=TGGAATTCTCGGGTGCCAAGGT --species osa

                  it gave following error
                  INFO: Trying to open directory /home/bioinfo.corp/Desktop/test_rna2map/test_flicker/FLICKER_201221_15.18.39/contam/reference ...
                  INFO: ... success, will output file sizes to XML
                  Making index /home/bioinfo.corp/Desktop/test_rna2map/test_flicker/FLICKER_201221_15.18.39/contam/reference/oryza_filter_reference.fa.idx
                  Fastq header (@SRR062265.47:HWI-EAS-58_4_FC20AY9AAXX:3:1:911:683:length=35) not proper length: 7 != 10

                  Can anyone explain me why it is giving this error?

                  Comment

                  • Jayu
                    Member
                    • Mar 2011
                    • 14

                    #24
                    all.summary.hist.txt and all.summary.tagHist.txt are the output of flicker. The is one column representing HNA.

                    Manual explained its as : HNA (Hit Normalized Abundance): Raw tag count/Number of spread (hits) to the database.

                    Can you please explain what is 'Number of spread (hits) to the database' ?

                    Secondly, there is another column 'Normalized count = (Column2/total count)*1 million' in 'all.summary.hist.txt' where column2 = HNA
                    Does it mean Normalized count is same as RPKM?

                    Comment

                    • Jayu
                      Member
                      • Mar 2011
                      • 14

                      #25
                      Can anyone suggest me from the following mapping tools which is the better tool and can be used for illumina small RNA data analysis?
                      Patman,
                      BLAST,
                      ELAND,
                      BWA,
                      Megablast

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Yesterday, 12:22 PM
                      0 responses
                      12 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-11-2026, 10:35 AM
                      0 responses
                      13 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-06-2026, 07:41 AM
                      0 responses
                      31 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      48 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...