Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA output interepretation

    Hi,
    I am finding bit difficulties in understading BWA output format (with indels) and following are my queries.

    Code:
    GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
    GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
    :i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
    1. XT:A:U means unique hits and XT:A:R means repeat..
    2. The above query has the desciptor as 70Match, 1 insertion and 4 matches (75 bp query). If I go to UCSC blat to check this part, first 70 bases matches with the ref (hg18) sequnces and the last GATC is not in that position followed by an insertion in 71st position. Its bit confusing at this stage.
    3. How to intrepret
    Code:
    XO:i:1  XG:i:1
    Number of gaps and gap extentions. If my understanding is correct, it opens 1 gap and extended to 1 base. I am trying to understnad the above read results.
    3. Sometimes BWA gives XA: (alternate hits) for XT:A:R (multiple hits). Is tehre any threshold for BWA to report these alternate hits. Sometimes I see X0:i:10 ( number of best hits as 10) but alternate hits reports only 3 or 4. Is there any threshold to report alternate hits as I believe BWA doesnot report all alternate hits for every multiple hits.
    4. I also want to know about the mismatch tag
    Code:
    MD:Z:71C0C1
    explanation.

    I would appreciate very much if someone could explain my above queries. Thanks.

  • #2
    Another example which has both deletions as well as insertion as below:

    Code:
    GA1_0001:5:1:2203:13069#0   0       chr7    143975167       37      68M1D4M2I1M     *       0       0       TCCATCACTGATCAAGAGTGGGGTGGCAGGTATTAGG
    GATAATATTCATTTAGCTTTCTGAGCTTTCTGAGATCG     CCCCCCCCCCCCCCCCCCCDCCCCCBBCCCACCCCCCCCCCCCCCCCCCCCCCCCC@CCCCCCCCCCBCACCCCC     XT:A:U  NM:i:4  X0:i:1  X1
    :i:0  XM:i:3  XO:i:1  XG:i:1  MD:Z:68^G1G3
    How do I intrepret the above result. Thanks.

    Comment


    • #3
      Can anyone comment on my queries above? Thx.

      Comment


      • #4
        Originally posted by seq_GA View Post
        Can anyone comment on my queries above? Thx.
        Sorry for my own impatience, but the answers can be found in the SAM spec and BWA manual.

        Comment


        • #5
          I did go through the manual and still couldn't figure out whether gap opened and extended are real one of any artifact as I am trying to validate the results.

          As I mentioned below

          Code:
          GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
          GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
          :i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
          I can't figure out MD:Z:71C0C1 and also, 1 gap is opened and extended one bp. But when I blat the same sequence in UCSC blat, its a perfect match.

          And tehre are some example as below whether both insertions and deletion occur in the same read. Is it possible? Thanks.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Recent Advances in Sequencing Analysis Tools
            by seqadmin


            The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
            05-06-2024, 07:48 AM
          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 05-14-2024, 07:03 AM
          0 responses
          20 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-10-2024, 06:35 AM
          0 responses
          44 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-09-2024, 02:46 PM
          0 responses
          54 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-07-2024, 06:57 AM
          0 responses
          42 views
          0 likes
          Last Post seqadmin  
          Working...
          X