Is there a way to report the right-most end of an alignment in a bam file? The position given is the left-most part of the alignment, but I need to know where the right-end falls in the reference. I know this can be done with the CIGAR string, but I'm concerned that I don't fully understand how the CIGAR string works with regards to hard & soft clipping, as well as what its reporting with regards to chimeric alignments. I think it might be easy to get this wrong if I'm not careful, and if there is an already existing, robust & convenient tool or method I'd prefer using that.
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
The easiest way to do this is to map with BBMap, using the "stoptag" flag, which will make it write an extra tag to each line prefixed by YS:i: which gives the read's stop location. I don't currently have a way to do that for existing sam/bam files, but I may incorporate it into reformat.
This is the code I use:
Code:public static int calcCigarLength(String cigar, boolean includeHardClip){ if(cigar==null){return 0;} int len=0; int current=0; for(int i=0; i<cigar.length(); i++){ char c=cigar.charAt(i); if(Character.isDigit(c)){ current=(current*10)+(c-'0'); }else{ if(c=='M' || c=='=' || c=='X' || c=='D' || c=='N' || c=='S'){ len+=current; }else if (c=='H'){ if(includeHardClip){len+=current;} }else if(c=='I'){ //do nothing }else if(c=='P'){ throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n"); //'P' is currently poorly defined }else{ throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n"); } current=0; } } return len; }
Code:public static String makeStopTag(int pos, int seqLength, String cigar, boolean perfect){ return "YS:i:"+(pos+((cigar==null || perfect) ? seqLength : -countLeadingClip(cigar, false)+calcCigarLength(cigar, false))-1); } public static int countLeadingClip(String cigar, boolean includeHardClip){ if(cigar==null){return 0;} int len=0; int current=0; for(int i=0; i<cigar.length(); i++){ char c=cigar.charAt(i); if(Character.isLetter(c) || c=='='){ if((includeHardClip && c=='H') || (SUBTRACT_LEADING_SOFT_CLIP && c=='S')){ len+=current; }else{ break; } current=0; }else{ current=(current*10)+(c-'0'); } } return len; }
Last edited by Brian Bushnell; 03-18-2015, 01:21 PM.
-
Originally posted by jmartin View PostIs there a way to report the right-most end of an alignment in a bam file?
Save the script as addReadEndToBam.py (or whatever). It will print to stdout in BAM format.
Example usage:
Code:addReadEndToBam.py in.bam > out.bam # Example output alignment: M00886:29:000000000-A95CG:1:2103:5504:6001 89 LmjF.01 4 0 34M = 4 0 CCCTAACCCTAACCTTGACCCTAACCCTATCCCT FB0AA0AAB1BBBA11GFCGFAB1>B1>1>>>>> XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:14C14A4 YS:i:37
Code:#!/usr/bin/env python import pysam import sys insam= sys.argv[1] samfile = pysam.AlignmentFile(insam, "rb") outfile = pysam.AlignmentFile("-", "wb", template=samfile) for aln in samfile: ys= aln.reference_end if not ys: ys= -1 aln.setTag('YS', ys) outfile.write(aln) samfile.close() outfile.close() sys.exit()
Comment
Latest Articles
Collapse
-
by seqadmin
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...-
Channel: Articles
05-24-2024, 01:16 PM -
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 06:55 AM
|
0 responses
12 views
0 likes
|
Last Post
by seqadmin
Yesterday, 06:55 AM
|
||
Started by seqadmin, 05-30-2024, 03:16 PM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
05-30-2024, 03:16 PM
|
||
Comprehensive Sequencing of Great Ape Sex Chromosomes Yields Insights into Evolution and Genetic Variability
by seqadmin
Started by seqadmin, 05-29-2024, 01:32 PM
|
0 responses
29 views
0 likes
|
Last Post
by seqadmin
05-29-2024, 01:32 PM
|
||
Started by seqadmin, 05-24-2024, 07:15 AM
|
0 responses
215 views
0 likes
|
Last Post
by seqadmin
05-24-2024, 07:15 AM
|
Comment