Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • paired end mapping using bowtie

    Hi all
    I'm really nub to working with bowtie. I have two fq files that contained paired end reads for a child . The files are child1-1.fq and child1-2.fq and I have a reference file with the name of ref.fa . I want use bowtie to map this paired end read to the reference seq and I'm using the following command but the output wasn't good. I think that I don't use correct option like -I and -X . actually I don't what should I select for those options .
    any suggestion will be nice.
    thanks you all.
    my command is:

    Code:
    bowtie-build  ref.fa ref_index
    bowtie -v 2 -S ref_index -1 child1-1.fq -2 child1-2.fq > child1_align.sam
    and the output is :

    Code:
    # reads processed: 25000
    # reads with at least one reported alignment: 16 (0.06%)
    # reads that failed to align: 24984 (99.94%)
    Reported 16 paired-end alignments to 1 output stream(s)
    some lines of child1-1.fq:
    @child_1192360_1192917_1:0:0_1:0:0_2dc6c/1
    GGACTTTGAGCTCGGGATGAATGTGCCTGCTGACTTTGCTGTTGCCTCTGTTGTAATCTATTATTCACTG
    +
    2222222222222222222222222222222222222222222222222222222222222222222222
    @child_652211_652627_0:0:0_2:0:0_2dc6d/1
    TTTTTATGAGCTCATGTTATAAATACAGATAAGACAGAATTGAGAACGAGGAGAAAGAGCGATCTATGCG
    +
    2222222222222222222222222222222222222222222222222222222222222222222222
    and some lines of child1-2.fq:
    @child_1192360_1192917_1:0:0_1:0:0_2dc6c/2
    GGAACTGGTCAAAAATATTAACACATATGGCTACACTTGGGAATTGATTAGTGCACATATGACACATCGC
    +
    2222222222222222222222222222222222222222222222222222222222222222222222
    @child_652211_652627_0:0:0_2:0:0_2dc6d/2
    ACTAAGATTTCATTCCAACACTACATTTTTTCGGAAAACGTTTTATTGAAGTACTGCTTTATGGTCAGCA
    +
    2222222222222222222222222222222222222222222222222222222222222222222222
    Last edited by mansoorhasani; 06-14-2015, 10:55 PM.

  • #2
    It looks like you have contamination. Running these through BLAST indicates they are from Saccharomyces cerevisiae, not human. So, you won't be able to map them to a human reference.

    Comment


    • #3
      Originally posted by Brian Bushnell View Post
      It looks like you have contamination. Running these through BLAST indicates they are from Saccharomyces cerevisiae, not human. So, you won't be able to map them to a human reference.
      thank you, my problem was solved by using bowtie2

      Comment

      Latest Articles

      Collapse

      • seqadmin
        The Impact of AI in Genomic Medicine
        by seqadmin



        Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
        02-26-2024, 02:07 PM
      • seqadmin
        Multiomics Techniques Advancing Disease Research
        by seqadmin


        New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

        A major leap in the field has
        ...
        02-08-2024, 06:33 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 02-23-2024, 04:11 PM
      0 responses
      57 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-21-2024, 08:52 AM
      0 responses
      67 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-20-2024, 08:57 AM
      0 responses
      56 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-14-2024, 09:19 AM
      0 responses
      65 views
      0 likes
      Last Post seqadmin  
      Working...
      X