Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Filter sequence from bed file

    Hello,

    I am very new to bioinformatics stuff. I have a bed file and I want to filter sequences which starts with GGG. I used grep but it gave all sequences that have GGG.

    This is example file:

    chr1 3165857 3165877 GGGGGGGTCGCCTTTAATAC_494 559.876 +
    chr1 3172959 3172979 ACGAGGGGGGTCATCTTTTT_1280 166.748 -
    chr1 3176088 3176108 ATCGAGGGGGTGATGTTTTT_2924 29.7413 +
    chr1 3207150 3207170 CCGGGGGAATCGACTTTGGA_265 795.823 -
    chr1 3207151 3207171 ACCGGGGGAATCGACTTTGG_186 884.041 -
    chr1 3207154 3207174 CCGACCGGGGGAATCGACTT_182 888.415 -
    chr1 3220405 3220425 TTGGGTGGGGGGCAGAGTCT_273 786.893 +

    Is there any way to define in grep (or anything else) to search in the beginning of the string?

    Thanks,
    Alan

  • #2
    If you want to exclude things that begin with GGG then do this (fields separated by space):

    Code:
    $ awk -F " " '$4 !~ /^GGG/ {print $0}' yourfile > new_file
    if you want to keep things that start with GGG then

    Code:
    $ awk -F " " '$4 ~ /^GGG/ {print $0}' yourfile > new_file
    If your file is tab-delimited then use

    Code:
    $ awk -F "\t" '$4 ~ /^GGG/ {print $0}' yourfile > new_file

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    34 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    37 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    31 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    53 views
    0 likes
    Last Post seqadmin  
    Working...
    X