Filter sequence from bed file

[illum]

Hello,

I am very new to bioinformatics stuff. I have a bed file and I want to filter sequences which starts with GGG. I used grep but it gave all sequences that have GGG.

This is example file:

chr1 3165857 3165877 GGGGGGGTCGCCTTTAATAC_494 559.876 +
chr1 3172959 3172979 ACGAGGGGGGTCATCTTTTT_1280 166.748 -
chr1 3176088 3176108 ATCGAGGGGGTGATGTTTTT_2924 29.7413 +
chr1 3207150 3207170 CCGGGGGAATCGACTTTGGA_265 795.823 -
chr1 3207151 3207171 ACCGGGGGAATCGACTTTGG_186 884.041 -
chr1 3207154 3207174 CCGACCGGGGGAATCGACTT_182 888.415 -
chr1 3220405 3220425 TTGGGTGGGGGGCAGAGTCT_273 786.893 +

Is there any way to define in grep (or anything else) to search in the beginning of the string?

Thanks,
Alan

[GenoMax]

If you want to exclude things that begin with GGG then do this (fields separated by space):

$ awk -F " " '$4 !~ /^GGG/ {print $0}' yourfile > new_file

if you want to keep things that start with GGG then

$ awk -F " " '$4 ~ /^GGG/ {print $0}' yourfile > new_file

If your file is tab-delimited then use

$ awk -F "\t" '$4 ~ /^GGG/ {print $0}' yourfile > new_file