Originally posted by Brian Bushnell
View Post
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Yes, that's does work. And it's more flexible and robust with different situations. Thank you for the great work. I've got a lot of fantastic script in bbmap!
-
Yep, it keeps the sequences in a.fasta that match sequences in b.fasta, and retains the names. You could alternatively run "filterbysequence.sh in=b.fasta ref=a.fasta out=c.fasta" to keep the names from b.fasta.
Leave a comment:
-
Thank you for your great work. I've tried the script with below two fasta files.
a.fasta
>1
aaaaaa
>2
tttttt
>3
gggggg
>4
cccccc
b.fasta
>1123-11234
aaaaaa
>wer
atgcca
>ad
ctaacg
>232-23424
tttttt
>323-342
cacaaa
>416-2
gggggg
>13424241234-23423
cccccc
>5-234
cggcgtcacgttggttgttga
running the script
filterbysequence.sh in=a.fasta ref=b.fas out=c.fasta ow=true
I've got c.fasta exactly same with a.fasta, is it supposed to replace identifier of the sequences in a.fasta from b.fasta?
Originally posted by Brian Bushnell View PostSo, I was inspired by this thread to add something into BBTools that could accomplish this. Thus, there's yet another method, "filterbysequence.sh". Usage:
Code:filterbysequence.sh in=a.fasta ref=b.fasta out=c.fasta
Leave a comment:
-
So, I was inspired by this thread to add something into BBTools that could accomplish this. Thus, there's yet another method, "filterbysequence.sh". Usage:
Code:filterbysequence.sh in=a.fasta ref=b.fasta out=c.fasta
Last edited by Brian Bushnell; 12-19-2015, 10:21 AM.
Leave a comment:
-
Another good method, thank you.
Originally posted by gsgs View Postonly those sequences with a "-" in the name ?
filtentr original 1 - > k1
[filters sequences (including name-lines) with - in the first entry]
names k1 5 5 > result
[only the raw sequence data, omitting the names]
using selfwritten simple programs filtentr.c and names.c
Leave a comment:
-
Yes, this time it works though the output is not as expected .
more out.fas
>1123-11234
--
gggggg
>13424241234-23423
>1123-11234
aaaaaa
ctaacg
>232-23424
>232-23424
tttttt
tttttt
>323-342
>416-2
gggggg
cacaaa
>416-2
>13424241234-23423
cccccc
Originally posted by GenoMax View PostAre you running bash shell? If you are not then try explicitly going into bash like this
Code:$ /bin/bash $ while read i ; do grep -B 1 $i original.fas ; done < sequence_file > out.fas
Leave a comment:
-
Admire you with the enthusiasm on programming, which makes an excellent programmer. Different running environment makes tons of unexpected problems that's why a robust code is really not easy to produce .
Originally posted by SES View PostThis is irrelevant now that the question is answered, but I can reproduce the "can't find getline..." error mentioned above that resulted from my first script.
The simple solution is to put "use IO::File;" at the top of the script. Apparently the behavior of Perl's I/O has changed (I'm using 5.22). Also, there are often OS-specific differences with scripting languages because the "perl" (or whatever) that the vendor distributes is not the same as what you compile yourself. So, it's possible there could be other tweaks required based on the system/versions, but it would be kind of a waste to go down that path since the problem is solved. Okay, now it's time to move on back to work...
Leave a comment:
-
only those sequences with a "-" in the name ?
filtentr original 1 - > k1
[filters sequences (including name-lines) with - in the first entry]
names k1 5 5 > result
[only the raw sequence data, omitting the names]
using selfwritten simple programs filtentr.c and names.c
Leave a comment:
-
This is irrelevant now that the question is answered, but I can reproduce the "can't find getline..." error mentioned above that resulted from my first script.
The simple solution is to put "use IO::File;" at the top of the script. Apparently the behavior of Perl's I/O has changed (I'm using 5.22). Also, there are often OS-specific differences with scripting languages because the "perl" (or whatever) that the vendor distributes is not the same as what you compile yourself. So, it's possible there could be other tweaks required based on the system/versions, but it would be kind of a waste to go down that path since the problem is solved. Okay, now it's time to move on back to work...
Leave a comment:
-
Originally posted by entomology View PostForgive my poor programming skill, still I got some error message as below
-bash: syntax error near unexpected token `do'
Code:$ /bin/bash $ while read i ; do grep -B 1 $i original.fas ; done < sequence_file > out.fas
Leave a comment:
-
Originally posted by entomology View PostThank you very much for your help. you are right, i get the order wrong. now it works really good with the updated version without warning.
the command test gives the result as below:
perl -v
This is perl, v5.10.1 (*) built for x86_64-linux-thread-multi
perl -MIO::Handle -e 'print IO::Handle->VERSION'
1.28
thanks again for your patience and useful help!!!
Leave a comment:
-
Thank you very much for your help. you are right, i get the order wrong. now it works really good with the updated version without warning.
the command test gives the result as below:
perl -v
This is perl, v5.10.1 (*) built for x86_64-linux-thread-multi
perl -MIO::Handle -e 'print IO::Handle->VERSION'
1.28
thanks again for your patience and useful help!!!
Originally posted by SES View PostYou must be giving the files in the wrong order because it works for me. It needs to be "perl script.pl original.fas other.fas." Though, the approach I posted is odd since there is something wrong with readline on your system and it will generate warnings. Here is a different approach that should work the same:
Code:#!/usr/bin/env perl use strict; use warnings; use File::Basename; my $usage = "perl ".basename($0)." seqsi.fas seqsj.fas > seqs_out.fas"; my $infilei = shift or die $usage; my $infilej = shift or die $usage; my $hash = index_seq($infilei); open my $inj, '<', $infilej or die $!; { local $/ = '>'; while (my $line = <$inj>) { chomp $line; my ($seqid, @seqparts) = split /\n/, $line; my $seq = join '', @seqparts; next unless defined $seqid && defined $seq; if (exists $hash->{$seq}) { print join "\n", ">".$hash->{$seq}, "$seq\n"; } } } close $inj; sub index_seq { my ($file) = @_; open my $in, '<', $file or die $!; my %hash; { local $/ = '>'; while (my $line = <$in>) { chomp $line; my ($seqid, @seqparts) = split /\n/, $line; my $seq = join '', @seqparts; next unless defined $seqid && defined $seq; $hash{$seq} = $seqid; } } close $in; return \%hash; }
Leave a comment:
-
Originally posted by entomology View PostI'm using centos
2.6.32-573.7.1.el6.centos.plus.x86_64
when i change as you recommended, this time I got result. but still with some error and the result seems not as expected.
./fetch_fasta.test seq.test seq.test.original.fas
Value of <HANDLE> construct can be "0"; test with defined() at ./fetch_fasta.test line 31.
>1
aaaaaa
>2
tttttt
>3
gggggg
I expected the result like this:
>1123-11234
aaaaaa
>232-23424
tttttt
>416-2
gggggg
>13424241234-23423
cccccc
Code:#!/usr/bin/env perl use strict; use warnings; use File::Basename; my $usage = "perl ".basename($0)." seqsi.fas seqsj.fas > seqs_out.fas"; my $infilei = shift or die $usage; my $infilej = shift or die $usage; my $hash = index_seq($infilei); open my $inj, '<', $infilej or die $!; { local $/ = '>'; while (my $line = <$inj>) { chomp $line; my ($seqid, @seqparts) = split /\n/, $line; my $seq = join '', @seqparts; next unless defined $seqid && defined $seq; if (exists $hash->{$seq}) { print join "\n", ">".$hash->{$seq}, "$seq\n"; } } } close $inj; sub index_seq { my ($file) = @_; open my $in, '<', $file or die $!; my %hash; { local $/ = '>'; while (my $line = <$in>) { chomp $line; my ($seqid, @seqparts) = split /\n/, $line; my $seq = join '', @seqparts; next unless defined $seqid && defined $seq; $hash{$seq} = $seqid; } } close $in; return \%hash; }
Last edited by SES; 12-18-2015, 02:14 PM.
Leave a comment:
-
I'm using centos
2.6.32-573.7.1.el6.centos.plus.x86_64
when i change as you recommended, this time I got result. but still with some error and the result seems not as expected.
./fetch_fasta.test seq.test seq.test.original.fas
Value of <HANDLE> construct can be "0"; test with defined() at ./fetch_fasta.test line 31.
>1
aaaaaa
>2
tttttt
>3
gggggg
I expected the result like this:
>1123-11234
aaaaaa
>232-23424
tttttt
>416-2
gggggg
>13424241234-23423
cccccc
Originally posted by SES View PostInteresting, never seen that. What OS are you using? To fix the Perl issue, replace this line:
Code:return unless my $entry = $fh->getline;
Code:return unless my $entry = <$fh>;
Leave a comment:
-
Originally posted by entomology View PostI've got below message when I running the script, do i miss some module?
Can't locate object method "getline" via package "IO::Handle" at ./fetch_fasta.test line 30
Code:return unless my $entry = $fh->getline;
Code:return unless my $entry = <$fh>;
Leave a comment:
Latest Articles
Collapse
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 04-25-2024, 11:49 AM
|
0 responses
19 views
0 likes
|
Last Post
by seqadmin
04-25-2024, 11:49 AM
|
||
Started by seqadmin, 04-24-2024, 08:47 AM
|
0 responses
17 views
0 likes
|
Last Post
by seqadmin
04-24-2024, 08:47 AM
|
||
Started by seqadmin, 04-11-2024, 12:08 PM
|
0 responses
62 views
0 likes
|
Last Post
by seqadmin
04-11-2024, 12:08 PM
|
||
Started by seqadmin, 04-10-2024, 10:19 PM
|
0 responses
60 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 10:19 PM
|
Leave a comment: