Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • SES
    Senior Member
    • Mar 2010
    • 275

    #31
    This is irrelevant now that the question is answered, but I can reproduce the "can't find getline..." error mentioned above that resulted from my first script.

    The simple solution is to put "use IO::File;" at the top of the script. Apparently the behavior of Perl's I/O has changed (I'm using 5.22). Also, there are often OS-specific differences with scripting languages because the "perl" (or whatever) that the vendor distributes is not the same as what you compile yourself. So, it's possible there could be other tweaks required based on the system/versions, but it would be kind of a waste to go down that path since the problem is solved. Okay, now it's time to move on back to work...

    Comment

    • gsgs
      Senior Member
      • Oct 2009
      • 139

      #32
      only those sequences with a "-" in the name ?

      filtentr original 1 - > k1

      [filters sequences (including name-lines) with - in the first entry]

      names k1 5 5 > result
      [only the raw sequence data, omitting the names]

      using selfwritten simple programs filtentr.c and names.c

      Comment

      • entomology
        Member
        • May 2011
        • 34

        #33
        Admire you with the enthusiasm on programming, which makes an excellent programmer. Different running environment makes tons of unexpected problems that's why a robust code is really not easy to produce .

        Originally posted by SES View Post
        This is irrelevant now that the question is answered, but I can reproduce the "can't find getline..." error mentioned above that resulted from my first script.

        The simple solution is to put "use IO::File;" at the top of the script. Apparently the behavior of Perl's I/O has changed (I'm using 5.22). Also, there are often OS-specific differences with scripting languages because the "perl" (or whatever) that the vendor distributes is not the same as what you compile yourself. So, it's possible there could be other tweaks required based on the system/versions, but it would be kind of a waste to go down that path since the problem is solved. Okay, now it's time to move on back to work...

        Comment

        • entomology
          Member
          • May 2011
          • 34

          #34
          Yes, this time it works though the output is not as expected .

          more out.fas
          >1123-11234
          --
          gggggg
          >13424241234-23423
          >1123-11234
          aaaaaa
          ctaacg
          >232-23424
          >232-23424
          tttttt
          tttttt
          >323-342
          >416-2
          gggggg
          cacaaa
          >416-2
          >13424241234-23423
          cccccc

          Originally posted by GenoMax View Post
          Are you running bash shell? If you are not then try explicitly going into bash like this

          Code:
          $ /bin/bash
          $ while read i ; do grep -B 1 $i original.fas ; done < sequence_file > out.fas

          Comment

          • entomology
            Member
            • May 2011
            • 34

            #35
            Another good method, thank you.

            Originally posted by gsgs View Post
            only those sequences with a "-" in the name ?

            filtentr original 1 - > k1

            [filters sequences (including name-lines) with - in the first entry]

            names k1 5 5 > result
            [only the raw sequence data, omitting the names]

            using selfwritten simple programs filtentr.c and names.c

            Comment

            • Brian Bushnell
              Super Moderator
              • Jan 2014
              • 2709

              #36
              So, I was inspired by this thread to add something into BBTools that could accomplish this. Thus, there's yet another method, "filterbysequence.sh". Usage:

              Code:
              filterbysequence.sh in=a.fasta ref=b.fasta out=c.fasta
              c.fasta will then contain all sequences shared by a.fasta and b.fasta. It supports case-matching or case-insensitive operation, and reverse-complement-aware or forward-only operation. And it can either do an exclusion or inclusion filter. Also, it can optionally reduce very large sequences down to their 128-bit hash-codes for low-memory operation (so, for example, you could easily filter sequences against nt or RefSeq microbial quickly in a small amount of memory to see if they are already present before adding yet another copy of E.coli, which is something NCBI absolutely needs to do). And it's very, very fast.
              Last edited by Brian Bushnell; 12-19-2015, 10:21 AM.

              Comment

              • entomology
                Member
                • May 2011
                • 34

                #37
                Thank you for your great work. I've tried the script with below two fasta files.

                a.fasta

                >1
                aaaaaa
                >2
                tttttt
                >3
                gggggg
                >4
                cccccc



                b.fasta

                >1123-11234
                aaaaaa
                >wer
                atgcca
                >ad
                ctaacg
                >232-23424
                tttttt
                >323-342
                cacaaa
                >416-2
                gggggg
                >13424241234-23423
                cccccc
                >5-234
                cggcgtcacgttggttgttga


                running the script
                filterbysequence.sh in=a.fasta ref=b.fas out=c.fasta ow=true

                I've got c.fasta exactly same with a.fasta, is it supposed to replace identifier of the sequences in a.fasta from b.fasta?




                Originally posted by Brian Bushnell View Post
                So, I was inspired by this thread to add something into BBTools that could accomplish this. Thus, there's yet another method, "filterbysequence.sh". Usage:

                Code:
                filterbysequence.sh in=a.fasta ref=b.fasta out=c.fasta
                c.fasta will then contain all sequences shared by a.fasta and b.fasta. It supports case-matching or case-insensitive operation, and reverse-complement-aware or forward-only operation. And it can either do an exclusion or inclusion filter. Also, it can optionally reduce very large sequences down to their 128-bit hash-codes for low-memory operation (so, for example, you could easily filter sequences against nt or RefSeq microbial quickly in a small amount of memory to see if they are already present before adding yet another copy of E.coli, which is something NCBI absolutely needs to do). And it's very, very fast.

                Comment

                • Brian Bushnell
                  Super Moderator
                  • Jan 2014
                  • 2709

                  #38
                  Yep, it keeps the sequences in a.fasta that match sequences in b.fasta, and retains the names. You could alternatively run "filterbysequence.sh in=b.fasta ref=a.fasta out=c.fasta" to keep the names from b.fasta.

                  Comment

                  • entomology
                    Member
                    • May 2011
                    • 34

                    #39
                    Yes, that's does work. And it's more flexible and robust with different situations. Thank you for the great work. I've got a lot of fantastic script in bbmap!

                    Originally posted by Brian Bushnell View Post
                    Yep, it keeps the sequences in a.fasta that match sequences in b.fasta, and retains the names. You could alternatively run "filterbysequence.sh in=b.fasta ref=a.fasta out=c.fasta" to keep the names from b.fasta.

                    Comment

                    Latest Articles

                    Collapse

                    • SEQadmin2
                      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                      by SEQadmin2



                      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                      Despite this, “CRISPR helped turn genome editing from a specialized technique into
                      ...
                      07-31-2026, 11:01 AM
                    • SEQadmin2
                      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                      by SEQadmin2


                      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                      The systematic characterization of the human proteome has
                      ...
                      07-20-2026, 11:48 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, Yesterday, 10:05 AM
                    0 responses
                    8 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 08-13-2026, 12:22 PM
                    0 responses
                    33 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 08-11-2026, 10:35 AM
                    0 responses
                    27 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 08-06-2026, 07:41 AM
                    0 responses
                    38 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...