Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Ben,

    I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.

    Chuck

    Comment


    • How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.
      After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?
      Please clarify about buinding different chrmosomes of hg18.
      Thanks.

      Comment


      • Originally posted by chuck View Post
        I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.
        Chuck - I turned this into a sourceforge issue so that we can keep all relevant info in one place and not clutter the forum too much:



        I'll keep looking at this. Thanks for the details.

        Ben

        Comment


        • Originally posted by seq_GA View Post
          How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.
          You can specify a comma-separated list of FASTA files as the input to bowtie-build. Example scripts that do this automatically (including the download step) are included in the 'scripts' subdirectory of the Bowtie package. E.g. scripts/make_h_sapiens_asm.sh

          Alternately, you can download a pre-built index from the Bowtie website.

          Originally posted by seq_GA View Post
          After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?.
          Yes, that's right.

          Ben

          Comment


          • Shaun or Ben,

            Did you guys get around this?

            Originally posted by ShaunMahony View Post
            Hi Ben,
            Here's one, but I can send you a whole file if you like:

            >Test:chr5:15656372:15656404
            CTGAGCAAGGGGACCCCAATGGAAAAGTTAGG

            This is aligned uniquely (and correctly) by most aligners, but is not aligned by Bowtie with the above arguments. I just noticed that when I remove the "-m 2" option, this read is aligned uniquely. This is counter-intuitive.

            What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.
            --
            bioinfosm

            Comment


            • Hi,

              Originally posted by bioinfosm View Post
              Shaun or Ben,

              Did you guys get around this?
              Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:

              What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.
              Why -m 2 instead of -m 1?
              I don't know myself why I've been using -m 2 instead of -m 1. I must have
              assumed at some stage that -m counted greater than or equal to.

              What definition of "unique" are you after? Is it (a) there are no other legal alignments period, or (b) there are no other legal alignments with the same number of mismatches as the best match? If (b), use --strata --best -m 1, rather than just -m 1.
              Is -k X guaranteed to report the lowest mismatch alignments first?
              Answer: yes, -k X --best will report the "best" alignments first.

              Ben

              Comment


              • thanks Ben ..
                --
                bioinfosm

                Comment


                • Thanks Ben.

                  Comment


                  • Hi Ben,

                    I get to see different output from the following examples. Please let me know whether I am intrepretting correctly.

                    Code:
                    ./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gtctggcggcggcctggcggagcg
                    1+:<21,21852845,0>
                    Reported 1 alignments to 1 output stream(s)
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gtctggcggcggcctggcggagcg -p 5
                    0  +  chr22 21852845    GTCTGGCGGCGGCCTGGCGGAGCG        IIIIIIIIIIIIIIIIIIIIIIII 0
                    Reported 1 alignments to 1 output stream(s)
                    
                    
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gaccaacttgttcagcgccttgat -p 5
                    1+:<5,132749285,0>
                    Reported 1 alignments to 1 output stream(s)
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gaccaacttgttcagcgccttgat -p 5
                    0  +  chr9  132749285   GACCAACTTGTTCAGCGCCTTGAT        IIIIIIIIIIIIIIIIIIIIIIII 0
                    Reported 1 alignments to 1 output stream(s)
                    In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

                    Please let me know.

                    Comment


                    • Originally posted by Ben Langmead View Post
                      Hi,



                      Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:



                      Answer: yes, -k X --best will report the "best" alignments first.

                      Ben
                      But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
                      Thanks

                      Comment


                      • Originally posted by seq_GA View Post
                        In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

                        Please let me know.
                        Hi seq_GA,

                        --concise rerports the reference according to its internal index, not its name. I.e., the '5' you're seeing is because internally, Bowtie identifies that chromosome as '5' (probably because when you built your index, it was the 6th sequence to be indexed; it's 0-based). If you ask for verbose (default) output and supply the --refidx option with your second input, you should also see '5' in the ref_id column.

                        Hope that makes sense,
                        Ben

                        Comment


                        • Originally posted by seq_GA View Post
                          But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
                          Thanks
                          If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

                          Ben

                          Comment


                          • Originally posted by Ben Langmead View Post
                            If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

                            Ben
                            Hi Ben,
                            Thanks for the clarification. It is still bit confusing. If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?

                            I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?

                            Regards

                            Comment


                            • Originally posted by seq_GA View Post
                              Hi Ben,
                              If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?
                              If you supply -m 1, Bowtie will suppress alignments for reads with more than 1 valid alignment.

                              Originally posted by seq_GA View Post
                              I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?
                              You must pick a definition of "unique." If "unique" = there are no other alignments with the same number of mismatches, then use '--best -strata -m 1', (along with your alignment policy, e.g. '-v 2'). If "unique" = there are no other valid alignments period, then use '-m 1'. The former is stratified, the latter is unstratified.

                              Ben

                              Comment


                              • Sorry if this has been answered before, but does Bowtie support FASTA nucleic acid codes that code for two bases, such as Y = T or C for the genome? Thanks in advance.

                                Comment

                                Latest Articles

                                Collapse

                                • seqadmin
                                  Best Practices for Single-Cell Sequencing Analysis
                                  by seqadmin



                                  While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                                  06-06-2024, 07:15 AM
                                • seqadmin
                                  Latest Developments in Precision Medicine
                                  by seqadmin



                                  Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                                  Somatic Genomics
                                  “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                                  05-24-2024, 01:16 PM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by seqadmin, 06-21-2024, 07:49 AM
                                0 responses
                                14 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-20-2024, 07:23 AM
                                0 responses
                                14 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-17-2024, 06:54 AM
                                0 responses
                                16 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-14-2024, 07:24 AM
                                0 responses
                                25 views
                                0 likes
                                Last Post seqadmin  
                                Working...
                                X