Originally posted by david2
View Post
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
n's in data
Hi Ben,
I have a couple of questions regarding how bowtie handles the data. I have a reference genome and a set of reads. My ref sequence has n's and a lot of reads also have n's in between.
How does bowtie handle these n's
1) while building ref genome index?
2) for reads?
Elsewhere in the same thread, I found you sayin that "When Bowtie indexes the reference, it elides non-A/C/G/T characters. So if you index a reference with stretches of Ns, Bowtie will never report an alignment spanning any of the stretches."
Does this mean you chuck n's while building the index? if yes, don't these n's have positional information? are these n's of any importance?
Thanks
Nash
Comment
-
Reverse complement
I am working on RNA-Seq data and I aligned the reads to a reference genome with bowtie.
I got the output files in SAM format and now I wonder how can I know for each read if it aligns directly or whether it is the reverse complement that aligns to the reference genome in the SAM format file.
I would really appreciate any help.
Best Regards
alvin
Comment
-
Hi All,
I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????
with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????
Thanks a lot.
jo
Comment
-
Originally posted by jyoshna.jo View PostHi All,
I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????
with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????
Thanks a lot.
jo
Comment
-
hg19 and allocation issues
I am new to bowtie and I am having a couple problems. First, I downloaded the hg19 ebwt files and attempted to transfer them to the server where I will be running bowtie but received errors for 5 of the 6 files. Despite the errors the file names still appeared on the server and to check if they were functional I tried a trial run:
./bowtie -c -t hg19 CTGAGCTTGACGCTTTGCTAATATNGTAAGAAGAGAAACTATTAATTATGGCTTTCTAAAATTGAATATCCTTGTACACA
this was the response:
Out of memory allocating plen[] in Ebwt::read() at ebwt.h:3153
Overall time: 00:00:00
What can I do?
Thanks, Greg
Comment
-
Originally posted by Xi Wang View PostGenerally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete
Comment
-
Originally posted by tonge View PostHi XiWang,
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete
Comment
-
Originally posted by tonge View PostHi XiWang,
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete
Originally posted by biznatch View PostI think it's because Bowtie doesn't recognize splice junctions. Ie. when you sequence your RNA is often aligns across introns so there is a large gap in the alignment. Tophat uses the Bowtie alignment algorithm but can align across splice junctions. ...or something like that.
Comment
-
Nowadays, spliced read mappers first split reads into segments, then apply mappers such as Bowtie to map those segments onto the reference genome. The segments belong to a read can be mapped with a long distance between, so that the splice junctions can be detected.
What Nishomer mentioned is an old version of Tophat, when the read length is short.
Comment
-
question about bowtie's handling of long reads
Hey guys,
I have a question about bowtie's performance when we increase the length of the reads. Initially i used to run bowtie for reads length = 35. Now I am running the exps with reads length 51.
When I read bowtie's manual, I noticed they say bowtie's performance decreases as the read length increases. On the contrary, i am seeing its performance become better when I shifted from 35 to 51. Could you guys please tell me why? is it normal for bowtie to behave this way??
how short is short reads and how long is long reads (in terms of base pairs) ?
Comment
-
Repeats
Does the hg19 index mask repeats in the genome?
I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?
Comment
-
Originally posted by gntc View PostDoes the hg19 index mask repeats in the genome?
I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?
Depends whether the index was made from the masked version of hg19 or not. I'm pretty sure the pre-made index from the Bowtie website is made from the non-masked genome. Both masked and non-masked are available here:
"chromFa.tar.gz - The assembly sequence in one file per chromosome.
Repeats from RepeatMasker and Tandem Repeats Finder (with period
of 12 or less) are shown in lower case; non-repeating sequence is
shown in upper case.
chromFaMasked.tar.gz - The assembly sequence in one file per chromosome.
Repeats are masked by capital Ns; non-repeating sequence is shown in
upper case."
Comment
Latest Articles
Collapse
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 05-10-2024, 06:35 AM
|
0 responses
15 views
0 likes
|
Last Post
by seqadmin
05-10-2024, 06:35 AM
|
||
Started by seqadmin, 05-09-2024, 02:46 PM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
05-09-2024, 02:46 PM
|
||
Started by seqadmin, 05-07-2024, 06:57 AM
|
0 responses
18 views
0 likes
|
Last Post
by seqadmin
05-07-2024, 06:57 AM
|
||
Started by seqadmin, 05-06-2024, 07:17 AM
|
0 responses
19 views
0 likes
|
Last Post
by seqadmin
05-06-2024, 07:17 AM
|
Comment