Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Deleting sequence lacking quality scores from FASTQ?

    Hello,

    I have a fastq with a sequence that's missing quality scores. See FASTQ Groomer error message below. How do I remove this sequence or otherwise fix this so that I can use this file in Galaxy?

    Thanks!

    Invalid FASTQ file: quality score length (0) does not match sequence length (44)'.
    The last valid FASTQ read had an identifier of '@157361978'.
    The error in your file occurs between lines '2625917' and '2625921', which corresponds to byte-offsets '131488615' and '131488674', and contains the text (59 of 59 bytes shown):

    @157362855
    ATGGAATTGGTAAAGCCATTGTAGAAATATTCTGTAAAAGTGGG
    +

  • #2
    I've used TrimGalore! And Prinseq for quality trimming, although not sure how it will handle reads with empty ph red scores.

    Comment


    • #3
      The problem in this case is not your tool, but that you have a corrupt (probably truncated) fastq file. Rather than find a tool that ignores the problem, you should re-download the file to get a non-corrupt copy. Do not use this file in Galaxy or anything else, because your results will be wrong.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      21 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      23 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      18 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      49 views
      0 likes
      Last Post seqadmin  
      Working...
      X