Deleting sequence lacking quality scores from FASTQ?

[bwc22]

Hello,

I have a fastq with a sequence that's missing quality scores. See FASTQ Groomer error message below. How do I remove this sequence or otherwise fix this so that I can use this file in Galaxy?

Thanks!

Invalid FASTQ file: quality score length (0) does not match sequence length (44)'.
The last valid FASTQ read had an identifier of '@157361978'.
The error in your file occurs between lines '2625917' and '2625921', which corresponds to byte-offsets '131488615' and '131488674', and contains the text (59 of 59 bytes shown):

@157362855
ATGGAATTGGTAAAGCCATTGTAGAAATATTCTGTAAAAGTGGG
+

[felvis56]

I've used TrimGalore! And Prinseq for quality trimming, although not sure how it will handle reads with empty ph red scores.

[Brian Bushnell]

The problem in this case is not your tool, but that you have a corrupt (probably truncated) fastq file. Rather than find a tool that ignores the problem, you should re-download the file to get a non-corrupt copy. Do not use this file in Galaxy or anything else, because your results will be wrong.