Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Lastz help

    Hi all,

    I'm trying to get lastz to compare some sequences to the human reference genome. This is the command I'm using:

    lastz /path/to/data/fastafile.fasta[multiple] /path/to/reference/reference_human.fa --format=difference --identity=90 --coverage=50 --output=/path/to/data/lastzout.fa

    This gives the following error:

    FAILURE: call to realloc failed to allocate 135087680 bytes, for add_segment

    Does anyone know what this means and what I can do about it?

  • #2
    Hi Esther,

    I am getting the identical error message when trying to align 454 run with ~8000 reads on an 80kb reference sequence, using:

    ./lastz brca1.fasta 454run.fna --format=sam --step=10 --seed=match12 --notransition --exact=20 --noytrim --match=1,5 --ambiguous=n --coverage=90 --identity=95

    Is there anyone out there who knows what we do wrong?

    I would like to replicate the Lastz parameters used on the public Galaxy server, does anyone know where I can find which parameters they use?

    Cheers,

    David

    Comment


    • #3
      I am using lastz for piler and my command is

      $lastz unigenes.fa[multiple][unmask] --format=maf > unilastz.maf
      FAILURE: bad fasta character in unigenes.fa, >Contig10: Y

      my contig10 is
      >Contig10
      TGAAAACTAATATATATATATGTAGCATACCTGGATTCAACTTTACTGGTGGTTCAACAT
      GAATCGTTCAAACAATTCCGCCTGTGCTTTTAGTTTCTCCAATTCGCCATTAGTCTTCTT
      ATTTTCCTCCTTTTGAGCCTCCAACTCCATCTTGAGGGTCTGAATTTCTTCTTTAGCACT
      CTCAAGCTGAGTTTGAGTCTCATTTATCCCAAAATAGCTATAGCGACGGGGCACCTTCAC
      CCCCCAACCCATACCTTTTTGATACCCTGATCTCACACCGAGAGTCTCAACCATAATCTC
      CTCTTCAGTCTTCGAATTTTCTCCATCCATCATAGACGATTCCTCCATTTCAGCCATTTT
      CTCCTGAAATTTATTATTAATATATGTGAAATTATGGTAAAAGAATAGTTCCAGAATTAT
      GGTAAAAGAATTGTTGAGGTGTTGAAACACAAGAGGTTTGGTGCAAAATTCCCTATTTTG
      TGTAGAGCAACTTACATATGTCATTTCAGCCTCTTCGTTCACGAATTTATTCACGAATTG
      ACCCTTCCTGCGAACATGATTATCCTTCCACAACAGAATCCTACTACGATTAACCTATAA
      GGAAAACATATACAATTACTAAGTTTCTTACCTCATCACAATATCCAGTATAGATATCTG
      AATTCAAAAATAGAGCACAAATATAGAAATATTAGATTTCAAAAATTGAAAGTACATACC
      ATGCTCCGGTAGCGAACAAGGTTTCTGGTCCTTCCTGATGTGTGGGGAAAAAGCATGCAT
      TTTCTATTTGCTTTATTGATGGCAGACCTCATCTACATCATAAACAATGAACAACAAATC
      AATTTTTTTTATTTAATAAGAACCTTTGGCCAAATATAATCCCAGCATCCATACAATTAT
      CTTTTGTCGCAGAAAAAAAGGAGAAACAGAGAGAGTGTTAGAATAAAAAGGCATACCTGA
      AAACGATCAGACTCAACGTGCTCACATAGTGCATGCCAACTCTCAACTGTGAGTTCTCTC
      CGCGGAATTGAATTTCTAGGTTGAAGCCCCTTGTTCTTCATATTTGTGTGGATCTTGCCC
      AACCTATATCTCCAATTTCTGTAATTTGTCTGGAGTGCTTGATCTATTATAGTCTGGATT
      CGCCAACTTGACAGGTCTTCAATCTCGAACCATTGCTAGTAATCAAAATATCTCTATCAT
      TACTTGTATATATAAAATAAAAAGAAAAACACTTGGCTTATTTGTTCGAGGAGAATAAAA
      AACTCACAAACTAAGGTGATTAAAAAGTAAAAATTACCAATAAATTTTCTAGACAAGCTT
      GCTTATTTGTACTAGAAACTTCCTTCCACTTTGACACGCCTTCAATATCCGCATGTGCTC
      TTACAGTAACCCCAATAGCATCAGCAAACTCTCCGGTATATTGTGTTGGTATTGTCTAAC
      AAGGATTAAAAACTAATTTCATCTTCCCATTCTGCGAAACAACATAATAATTAGAGAGTT
      AAATTCATAAAACAAGATCTCCAATTTTCACAGATTAGAATATTGTACCCGTTTCACCAT
      CTTATCGAGGTGCAGGCCTCTACCCGGACCGTGAGTATTCTGTTTAGGCTTTGATCCTAA
      ATAAAAAGTTATTGAAATAGTGTTAATGTTCCCTAAAGATACTAAACTAAATAAATATGT
      TCCGCAAAGAATAAAGAATAGAATTAAAAAAAAAAAATGAAACCAAACAACATACCAATG
      GTTGTTCCTGCAGATCCTTCTAGAGTTGCTGAGACAGGAATAGATGGAGGCTGACGCACA
      CTTAAATTAGGAGATGAAGCAGTGGACCTTAGAGTATTTCCAGCAGTGGTGGATGTGGAA
      GTTGACATATTAGATGCTACATATTTGGATTTTGAAGCAGCTGGAATTGGTTGTTTATTA
      ACCACTGAAGTGGAAGGCCTGGAAGTTGACGGCTGGAATTTCAAAGTTGGTGGAATTGAT
      GCAACATTTCCAGACGTAACATGTACCTGGGGCTGTTTATTAACCACTGTAGTAGAAGGT
      CTGGAAGTTGACGGTTGGAATTTCGAAGTTGGTGGAATTGATGCAACATTTCTAGTCGTA
      ACATGTACTTGGGGTCGTACAAACCTCTTGAACTTTGGTCCTCCTGACATCTGAAAAAAT
      AAAAGACAAAAAGATATCAGTATGCATGATATAAAGATGAAGAGTTAAAGTATATGCTAC
      ATATTCAGTAAAGTGTATTACATTGAATAGGCCGAAAAACAGTTAAAAAAGAAAAACCAA
      AGCTATAACAGTTCTTGCATATTCTCTTATAACTAATAAAGAATGAGTTAATAAAAATAA
      ATCCTCCTCTTCTTCTTCTTCTTCTTGTTCATTTCTTCTTCTTCTTCTTCCTCCTCCTCC
      TCTTCTTCTTCCTCCTCTTCTCCCTCCTCCTCATATGATTGTTCAGTATTTTGATTTCTG
      GACTTTCTAATGCTTTCAAAGATCATCCTATCAAGCTCTTCAGGTTCTAAATCGTCCCTT
      GCCAATTGCCGTCGACCATTCTGCTCACTTGCTTCTTCAATTGGATCAACACGAGTAGAT
      TCATATTGCTGAACAACCTCTGCCACAAATTCTTGTTCATTAATGGTTGTTTTGTCCACA
      ACATCATTTACAGCTGATTCACAAACATCCCACAAATGCCTATGTGAAACTCTCTGCACA
      ACCTTCCAATTTTTACCCAGTTTTGTGTCATTCACATAAAACACTTGTTGTGCCTGGACA
      GGTAATATAAATGGTTGCTCCTTGTACCACCTAGAGCTAACATCAACACTAATGAAATGT
      TTATCCTCTTGGATAAATTTATTACTTCCAGAGTTGAACCACTCACAATCAAACAAAACC
      ACTTTTCTACCACCAATATATGTTAACTCCACAACCTTTCTCAAGAAACCGAAAAACTCA
      ACCGGCTTCCTCTTATGAAATCCTCCAACTACAAGGCCACTATTTTGAGTTTTCGTCGTC
      TGTCACAATCCCTTGTATGAAACCGGACCTGATTCACCATGCATCCATTATAAAAATCTG
      AGCTCAGCCTCGAAGGACCATTTGCTAAAGCCCACAGCTCAGTTGTAATTTTGTCTGCTT
      TCTGAAAATGCAACAGACCCATCTACAAGATAATATAATAGTTAGAACAAAGTATTCTGC
      TAAAATCATTTAAGTTCAGAGTATAAGTTATCAACTAAAGGAAATAAACTAACATGTTTT
      TAAACCACTGTGGGAAGGTGTTTTTCTGCCTTGGGTCAAGTTCATCCATGTTACCCACTT
      CTTCTACGGTAATTCCTTGCAATTCAGCTCTATGCATTCTGAAAAGGGCATAACCATTAG
      ATTACAAATAAGTTTATGGTTGTCAAGTGTCAACAAAACACTATGTATTACCACAGTGAA
      CGGGTACATCATACTGCCTCAATCCAAACATGGAATAACATCATAGTTACTTAAGTTTTA
      CTATCAACAGTAACTATCTAAAATCAGCAGCAGGTATATGCCTAAAGATACTGGAACAAA
      TCAGTAACTATCTAAAATCAGCAGCAGGTATATGCCCAAAGATACTGGTAGTCATAGTTC
      AGACAAAACTCGTAGACATAAGATAACAATAGAGAGAGATAAGTATTTCTTACTTTAGAT
      ATGGCTCAACTTCATCACAATTGCACATTATGTACCAATGTGCCTCATCTAATTCTCCTC
      TAGTCAAAGAACACTTGGGGCTAACTTCCCCAAATGGACGAGTTCTCATTGAAAATACAG
      AAATTCCTTCCTTTTGTTGACCATAGACACCATCAAAATTCCGTGGAAGGCAATTAAATT
      TAGTTTCCATGTCCATAGGCAAATGCATAGAAAAAAATGTGATGTTCTCATGCACCAAGT
      ATTGTTTAGCGATGGAAGCTTCAGGATGATTTCTATTTCGGATAAAGCCTGTGAGAGATC
      CCAGAAACCTAACAATAAGAAGGAAAGTAAACACCGTAGAATCAGAATCATGATACAGTT
      AAAATCAGAATCATTGCATCATATATATCTCAAAAATTTCACCTGGCAGAAGCCGCATAA
      GATGTTCCTTAGACACAATATATATCTCAAAAATTAAGGCTTGAAATCAAGTAAAAATGC
      AAAATAAATCAAGGCCAAATAAAATGTTACTCTGATTTCATACCACAAACAACACAACTT
      GTATGAGTACAGATCAGCAGCCAACTTAATAGACCAGAACACAAACTTAATAGACCAGAA
      CACAGAATCACAAACTTATTCGACAATCACACGAAGGGTCACAATAAAAACTAACCTTTC
      AAAGGGATACATCCAGCGAAATTGCACGGGTCCTGCAATCTTAGCCTCTTGGGCCAAGTG
      GACAGATAAATGTACCATAATTGTGAAAAAGTAAGGTGGAAATATCTTCTCCAACTTACA
      TAAGATAATTGGTATATTTTCATCCAACCGATTCACATCTTCGTCATACAAGGTCTTGGA
      ACATAATTGCTTAAAGTAATCTCCTAATTCACATAAAGCGTCCTTCACTTCCTTGGTCAA
      GTAACCACGAATTCCAGCAGGAATTAATCTCTGGAGTAGAATATGACAGTCATGGGACTT
      CAGTCGTGATAATTTATCCTTTTTCACACGTGCTGAGATGTTAGAAGCAAACCCATCAGG
      AAACTTAACTAACTTCAGAAACTCCAAGACTTCTCCTCTTTCACTTGGGGATAAGGTAAA
      ACATGCAGGTGGCCTGAATATTTTATTGCCATTATCTTGCAGGTGCAGCTCCTTCCTAAT
      ACCCATATCGCGTAAATCTTCTCTTGCAACATTAGAGTCTTTTGTTTTCCCTTTAATATC
      AAATAATGTACCAAGGACATTATCACATATATTCTTCTCAACGTGCATCGGATCGAGATT
      GTGCCTTATCTTCAACATGTGCCAATATGGCAGCTGGTAGAAACCACTTATTTTATCCCA
      ATTTACTTGATCCGAATCACGCTTTCTTTTACGATTTCCAGCTGCAATGAACACATCTTG
      CAATGAATTAAGCCAATACAATATTTCTTCACCTGAAAGTTGTTTAGGTTTCTCTCTATG
      CTCCTCTTTACCATTGAAAGTTAAACTTGTTCCTGCGGAATGGGTGTCTTTCGGGTAGAA
      AACGACGATGTCCCATGTAACATATCTTTGTTCGTAATTGTGTAGAATCTGTCTCATCAA
      GACAGCATGGGCATGCATAATAACCTGATGCTTGCCACCCTGACAAAAGACTATAACCAG
      GCAAGTCGCTTATGGTCCACAACAACACAACACGCATTAGAAACTTCTCTTTTGTGAGAG
      CATCATAAGTTTCGATCCCAACATCCCATAACTCCTTCAAATCTTCGATTAAGGGCTGCA
      AATACACATCAATGTTTTTCCCAGGATAATTTGGGCCCGGTATAAGCAGCGACAACATAA
      GAAATGGTTCACGCATACAATCATAAGAGGGCAGATTATAAACAACAAGAATCACGGGCC
      AAATGGTATGCGAATTCCCGATGTCTGACCATGGAGTGAATCCATCACATGCTAAACCCA
      ACCTAACATTCCGTGCATCCTTAGAAAACTCAGGAAATAGACTATCAAGGTGTTTCCAAG
      CCAATGAATCGGCTGGATGTCTTGAGACTCCATCCTCAACTTTGCGTTTATCTTTGTGCC
      AACGCATTTTTGCAGCCGTTTTGGTGAATGCAAAGAGTCTTTGCAACCGGGGCTTCAAGG
      GGAAGTATCTCAATTTCTTATGAGCAACTCTCTTTATCTTACTACCAAGCGGCTGCCACC
      TAGATTCTTTACAAACTGGACACTCGTTCATATTTTCATTCTCTTTCCGGAATAATACAC
      AACCGTTCTTACATGCATCAATCTCTTCATACCCTAGTCCAAGTTCACGCAGCTCCTTCT
      CAGCACCATATAATGACGATGGAAGAGTTTCACCTTCGGGTAAGATGCCTTTTATAAAGT
      CCAGCAGCATACTGAAAGACTTGTCCGTCCATTTATCCTTAACTTTCAGATGTAGCAGTT
      TTAGGGTAGCTAAAAGTGATGAAGTCTTACAGCCCGGATATAATTCATTTCTGGCATCAC
      CCACCAACTTCTGGAATCTTTCTTCTTCTTCTTCTTCATAGTCGCTGTCCACATGTTGAC
      CTTCAACCAATTCATCCAAGTACCCATTGATCGAACACATTAAATTCGACATCATCATTA
      CCTTGATCATTTTCCTCATAATCATCAACACCCTCTGTTTCTGCTAGGAACTCATTTATC
      TCGTCCTCGGATGGTAAACGAACATCATTATCAGTATCCTCATCATTTATATCAAGCTCT
      TTCTCTCCATGATTGTTCCAAAGTACATATGTACGAGAAAATCCATTAACGTGTAAATCC
      TTTTCAACCTCATCTATGGGCTTGTAGAATGAGTTGTTGCAAACCACACATGGACATTTA
      ATCATGTTATCACTCCCCATCACATTATCAGCAGCAAACATAAGAAAACATTGCACACCA
      TCCATATAAGAATTCGAAAACTTATTATGCTCTCTAATCCAACTTTTGTCCATTATCATT
      ACGTTGTACCTAAGTAATAAATAGCTCAGGAAAAATATAACTCTGGCAAGTAGCTCAGGC
      CTCAAATTAATAAATACCATATAAACATACACAAGTCAAATAATATCTACATAAGTAGAG
      GAACAATCTGAAGCCAAATAATAAACATAGATACAAATATTCATCTAGAACTTATCAATA
      TACACATACAGAAACGTGCCTAAATCATAAATTTTAGGAGAATTGAACTACATCAAAGTT
      TGAAGTACATCATACCTTCTCTAACAAAGGACACAGCACAAACTTCGGATTTGGATAATG
      ATTTGATCAAAGCTTGCTCCTCCAGATTCAAACGCAGCCACACTTCACAGTTGCTAGCCG
      ATTCAAACGCGCCACCAGATTCAAACGCGCCACCAGATTGAAACACGATCCATCAGACGC
      CTATCATTAACCTTCCTTTCCTGAATCTCCGATTGATAGTGTTGTACTGTTGTGTCGTGT
      GATTAGATTTAGATCGATCGAAATTAGGGTTTTAGTAAAAGGGATTTTTGTTTGTGACTG
      TGGGTTTCTGTCTAAGTAACGAAGAAGATGAAGTTATCTGATTCCCTTTTTAAAACTTAT
      CCTTAATTGCAAAAAAGCCCAAAAGTGTTTCTTATTAACAAATATGCCGCCGAATTTTCT
      TTCTTTCACAATTTTCAAATTTTATCATCTAAGAGCCTATTTTTCTATGATAATTTATTA
      TATTTGTCATTCTAAAATATTTTTATTTGATAATTTAGTCTAAAAATGTCATCGTAAAGT
      TTAATTGTGGTGACAAGTTTTAAGGTGCCACCTAATAGTTACTTTTATTTGATAATTTAY
      CCTAATGTCATTTAAAACTAGTCATCTAACATCCTTTT

      can anyone tell me why it is showing error and where it is wrong..??

      Thanks....

      Comment


      • #4
        As the error says you have the character "Y" in the second last line of the contig you have posted above.

        You may have to specify option "--ambiguous=iupac" for lastz. That comes with a caveat as explained in the README so be sure to check the explanation for that specific option here: http://www.bx.psu.edu/~rsharris/last...z-1.02.23.html

        Comment


        • #5
          Thank U ... GenoMax

          Comment


          • #6
            Hi,
            I am using lastz with this command but it is running from last 4 days and it is around 73.4 gb now. I am not able to understand why it is still running or i did wrong. Can any body guide me ?

            lastz unigenes.fa[multiple] unigenes.fa --notrivial --format=maf --ambiguous=iupac > unilastz.maf

            Thanks..

            Comment


            • #7
              Are you searching the "unigene.fa" file against itself? If so how big is that file?

              As indicated in the help page for lastz comparing entire chromosomes only takes a few hours. So 4 days seems long.

              At this point in time you are too far into the computation to cancel and investigate other options like (--notransition or --step) which are supposed to lower sensitivity and run times. If you are using a cluster you can always start another job with these options and see if second job finishes before the first one.

              Comment


              • #8
                Thank U ... GenoMax

                ya I am searching the "unigene.fa" file against itself and my file size is 334mb. I am running lastz on my system which is 16gb of ram and 8cpu.

                Comment


                • #9
                  Originally posted by Esther View Post
                  Hi all,
                  FAILURE: call to realloc failed to allocate 135087680 bytes, for add_segment
                  Howdy, Ester,

                  Sorry for this late reply. I am new to seqanswers today.

                  Are you still having this problem? If so, please email me so I can figure out why this is happening (you can find my email address in the lastz readme).

                  That error report is a failsafe and probably means that memory fragmentation is happening. I've never actually seen that error manifest in my own use. My best guess as to the cause is very high repeat content. But that's just a guess.

                  Bob H
                  (lastz author)

                  Comment


                  • #10
                    Originally posted by david2 View Post
                    I am getting the identical error message when trying to align 454 run with ~8000 reads on an 80kb reference sequence, using:

                    ./lastz brca1.fasta 454run.fna --format=sam --step=10 --seed=match12 --notransition --exact=20 --noytrim --match=1,5 --ambiguous=n --coverage=90 --identity=95
                    Howdy, David,

                    I'm very surprised this could be happening with such a small problem. Could you email me directly (my address is in the lastz readme)? I'd like to run the same sequences here so I can figure out how that memory allocation condition is being triggered.

                    Bob H
                    (lastz author)

                    Comment


                    • #11
                      Originally posted by Bob-Harris View Post
                      That error report is a failsafe and probably means that memory fragmentation is happening. I've never actually seen that error manifest in my own use. My best guess as to the cause is very high repeat content. But that's just a guess.
                      I'm expanding on my earlier answer, since other users may encounter this problem and google leads them to this page.

                      My best guess when this happens is that the input sequences contain a lot of unmasked repetitive sequence. The simplest (probable) solution is to split the target into several runs, for example, have a separate run for each of some subset of the target sequences. The other possibility would be to softmask repeats the sequences (assuming they aren't already), but this can be time consuming as well.

                      In detail. Internally, lastz processes one query at a time. It identifies HSPs (high scoring ungapped alignments) between the query and all the target sequences, collects these into a table, and then proceeds to the gapped alignments stage. There is one segment in the table for each HSP. The amount of memory allocated for the table grows as more segments are needed. If allocation fails, a message is generated indicating a memory allocation failure in add_segment.

                      Even if such a large memory request could be satisfied, this wouldn't really solve the problem. Most likely the program wouldn't finish in a timely fashion.

                      The cause of such a large number of HSPs is usually something like an un-masked microsatellite, a long sequence with a short repeat period, e.g. AGTAGTAGTAGTAGT. These are problematic since, in the HSP finding stage, every shift by a multiple of the period looks as good as any other. If your lastz parameters allow for high divergence then highly-diverged microsatellites will have a similar effect.

                      If you are running several queries, it is often just a few queries that contain the problematic element. You can find out which query is being processed at the point of failure by adding --progress to the command line.

                      Bob H
                      (lastz author)

                      Comment


                      • #12
                        Lastz output problem

                        Hi all,

                        I am graduate student in bioinformatics.I am working with Lastz, trying to compare two dna sequence files of sparrow genome.

                        my command is
                        lastz GCF_000385455.1_Zonotrichia_albicollis-1.0.1_genomic.fa[multiple] Capensis_both_Out.txt.scafSeq --format=difference --output=/net/home/skothapalli/result.fa

                        output was
                        lastz: No match.
                        what does this mean? Can someone help me out!

                        thanks in advance,
                        Sam

                        Comment


                        • #13
                          re: Lastz output problem

                          Originally posted by skothap View Post
                          output was
                          lastz: No match.
                          what does this mean?
                          This is apparently a message from your shell. The string "no match" isn't something lastz ever outputs.

                          I've seen this reported a couple times before, but I've never found a machine that does it. There is more information about that in this thread (search down the page for "no match"):
                          Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc

                          My second post in that thread (05-15-2014, 07:28 AM) contains a workaround.

                          Originally posted by skothap View Post
                          my command is
                          lastz GCF_000385455.1_Zonotrichia_albicollis-1.0.1_genomic.fa[multiple] Capensis_both_Out.txt.scafSeq --format=difference --output=/net/home/skothapalli/result.fa
                          The command looks fine, but just FYI the output format won't be fasta.

                          Bob H (lastz author)

                          Comment


                          • #14
                            Hi Bob,

                            I ran ls -al 'which lastz' and my output was
                            skothapalli@bioinformatics:/net/common/data/sparrow_project$ ls -al `which lastz`
                            -rwxr-xr-x. 1 root root 435735 Jun 17 14:33 /usr/local/bin/lastz

                            and I am working in the following path:
                            /net/common/data/sparrow_project

                            So,do I have to change path somewhere?

                            thanks in advance,
                            Sam

                            Comment


                            • #15
                              Well I just typed a longer reply but when I submitted it my browser failed. If this post is successful I will try again.

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                The Impact of AI in Genomic Medicine
                                by seqadmin



                                Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
                                02-26-2024, 02:07 PM
                              • seqadmin
                                Multiomics Techniques Advancing Disease Research
                                by seqadmin


                                New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

                                A major leap in the field has
                                ...
                                02-08-2024, 06:33 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, 02-28-2024, 06:12 AM
                              0 responses
                              21 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 02-23-2024, 04:11 PM
                              0 responses
                              69 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 02-21-2024, 08:52 AM
                              0 responses
                              77 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 02-20-2024, 08:57 AM
                              0 responses
                              67 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X