finding the Insertion Sequences (IS elements) in draft genomes.

[Krish_143]

Hi,

Is there any tool or a simple method ??

How to detect the IS elements from the draft genome (bacteria).
I have tried ISsaga (using ISfinder) and ISQuest.

ISsaga annotate the draft genome.. But, It changes the FASTA header (Input) to there own header format.
eg:

Input FASTA file.

>Test1
ATGATAGCACCGAGTAGAGGGACAGCAGATAGCAGATGCAGTCGATGAGCTG
>Test2
ATCTAGAGCACGCATCGACTGCACTACGGGCACCCACTG
>Test3
ATCTACCCAGCTAATCACGCATCGACTGCACTACGGGCACCCACTGGCACAGCG


Predicted IS output file.

IS Features Prediction & Estimation
Contigs/Scaffolds Analyzed

CtgIS_02bf81b8_1 (Test3 ~ example)
CtgIS_02bf81b8_2 (Test1 ~ example)
(Also, it was not in the same input order.. )
Is there anyway to keep the same scaffold header based on ISsaga output results?? That will be good for the Comparative genome analysis.

ISQuest
For using this method, must provide RAW reads.. It would be good if it has executed based on the draft genome.

Any suggestions for the other tools !
Thank you