Hi All,
I have met a strange problem when using newbler to trim vector sequence. The vector structure is:
Forward Primer ----> CDNA sequence ---->Reverse Primer
I was told only the three parts (forward & reverse primer, CDNA) could be sequenced. At first, I just used the flanking sequences, i.e. the primer sequences, for vector trimming (newbler -vt flanking.fa ...). I found some vector sequences remained in the result. For example:
vector sequence in assembled contig:
AATGCCAACTTTGTACAAAAAAaGTTGGCACC
part of the primer sequence:
AATGCCAACTTTGTACAAAAAAGTTGGCACC
I don't understand why this sequence haven't been trimmed. The contig just has one additional "a", which should be a sequencing error.
Then I added the full vector sequence into the file used for trimming. It seems that the result becomes better this time, although there are still some non-CDNA nucleotides appeared in assembled contigs ( I have aligned some of the contigs to reference sequences, and found some terminal nucleotides failed to be aligned)
I was told the flanking sequences were sufficient for vector trimming, but I observed an improved result by using full vector sequence. Is full vector sequence indeed necessary, or I have made something wrong in vector trimming?
Thanks in advance!
I have met a strange problem when using newbler to trim vector sequence. The vector structure is:
Forward Primer ----> CDNA sequence ---->Reverse Primer
I was told only the three parts (forward & reverse primer, CDNA) could be sequenced. At first, I just used the flanking sequences, i.e. the primer sequences, for vector trimming (newbler -vt flanking.fa ...). I found some vector sequences remained in the result. For example:
vector sequence in assembled contig:
AATGCCAACTTTGTACAAAAAAaGTTGGCACC
part of the primer sequence:
AATGCCAACTTTGTACAAAAAAGTTGGCACC
I don't understand why this sequence haven't been trimmed. The contig just has one additional "a", which should be a sequencing error.
Then I added the full vector sequence into the file used for trimming. It seems that the result becomes better this time, although there are still some non-CDNA nucleotides appeared in assembled contigs ( I have aligned some of the contigs to reference sequences, and found some terminal nucleotides failed to be aligned)
I was told the flanking sequences were sufficient for vector trimming, but I observed an improved result by using full vector sequence. Is full vector sequence indeed necessary, or I have made something wrong in vector trimming?
Thanks in advance!
Comment