Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • sulicon
    Member
    • Aug 2010
    • 41

    #1

    Vector trimming: are flanking sequences sufficient?

    Hi All,

    I have met a strange problem when using newbler to trim vector sequence. The vector structure is:
    Forward Primer ----> CDNA sequence ---->Reverse Primer

    I was told only the three parts (forward & reverse primer, CDNA) could be sequenced. At first, I just used the flanking sequences, i.e. the primer sequences, for vector trimming (newbler -vt flanking.fa ...). I found some vector sequences remained in the result. For example:

    vector sequence in assembled contig:
    AATGCCAACTTTGTACAAAAAAaGTTGGCACC

    part of the primer sequence:
    AATGCCAACTTTGTACAAAAAAGTTGGCACC

    I don't understand why this sequence haven't been trimmed. The contig just has one additional "a", which should be a sequencing error.

    Then I added the full vector sequence into the file used for trimming. It seems that the result becomes better this time, although there are still some non-CDNA nucleotides appeared in assembled contigs ( I have aligned some of the contigs to reference sequences, and found some terminal nucleotides failed to be aligned)

    I was told the flanking sequences were sufficient for vector trimming, but I observed an improved result by using full vector sequence. Is full vector sequence indeed necessary, or I have made something wrong in vector trimming?


    Thanks in advance!
  • flxlex
    Moderator
    • Nov 2008
    • 412

    #2
    This is not good... It's a bug (I'm pretty sure) with newbler that surprises me. You cannot change the parameters for trimming so I am afraid you are out of luck there. If using the full vector helps then use that!

    One thing to try is collecting the variant sequences of your primers and using them all in your trimming file, that might help...
    Last edited by flxlex; 09-20-2010, 07:03 AM. Reason: Typo

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 08-13-2026, 12:22 PM
    0 responses
    28 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-11-2026, 10:35 AM
    0 responses
    22 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    37 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    51 views
    0 reactions
    Last Post SEQadmin2  
    Working...