Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Chief_Lazy_Bison
    Junior Member
    • Dec 2014
    • 9

    Thank you for the quick advice. I had attempted to merge many samples together at the front end of the pipeline so that I could to all the QC and error correction at once. My problem was fixed when I did QC and error correction on each sample individually and then merged for a co-assembly.

    Thanks again.

    Comment

    • DCZ
      Junior Member
      • Feb 2019
      • 4

      Hi all,

      I was wondering why the default for spantiles is set to false. If a read for instance has coordinates (1000,1000) and the dupedist is set to 2500, (see sketch attached), there's a possible overlap with 3 other tiles. So even if it's not a NextSeq, but a HiSeq4000 for instance, there are no tile-edge duplicates, however there's still a possibility that optical duplicates end up on neighboring tiles (or even further). Can anyone elucidate on this?

      Thanks in advance!

      Attachment: The dot represents the "original read", the circle represents the distance of 2500 around the "original read". Rectangles represent tiles.
      Attached Files
      Last edited by DCZ; 05-23-2019, 07:27 AM.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        Illumina's software pre-processing takes care of clusters that may be showing mixed signals etc so they may never pass that step. Spantiles=t is mainly for nextSeq, where the clusters are hugh (relatively) and as a result there is a chance they will cross tiles. I believe this was done based on empirical observation Brian had done when he was developing clumpify.

        Comment

        • DCZ
          Junior Member
          • Feb 2019
          • 4

          Thanks for your reply. I'm still confused though. Just like there can be empty wells on the same tile, there can also be empty wells on neighboring tiles (correct me if i'm wrong). I suppose these wells would not show a mixed signal but would just get filled with a duplicate in the same way as the optical duplicates get formed on the same tile.

          Comment

          • phylloxera
            Junior Member
            • May 2017
            • 5

            Hi, I've been using clumpify for sometime now. Thanks!
            Seem to have encountered a strange and unexpected result.
            pigz -dc test.fna.gz | grep "^>" | wc -l #4149
            ~/bbmap/clumpify.sh in=test.fna.gz out=test_dd.fna.gz dedupe subs=0
            #Version 38.51
            #Read Estimate: 352386
            ...
            #Reads In: 2
            #Clumps Formed: 2
            #Duplicates Found: 0
            #Reads Out: 2
            ...
            pigz -dc test_dd.fna.gz | grep "^>" | wc -l #2

            Any idea what might have happened?

            Comment

            • phylloxera
              Junior Member
              • May 2017
              • 5

              Looks like everything went fine after I 'unwrapped' the input fasta.

              Comment

              • stevekm
                Junior Member
                • Nov 2015
                • 1

                Is there any method available to run Clumpify directly from within another program? Such as a library that could be imported? I saw that the main Clumpify program is written in Java, however, I am not a Java programmer. Not sure what other options there might be if I want my own custom program, which outputs fastq data, to pass the output directly to Clumpify, especially considering the handling the paired-end files.

                Comment

                • duartemolha
                  Junior Member
                  • Mar 2011
                  • 2

                  I am having problems using clumpify with my fastqs and I beleive it is related to the UMI on the header of the fastq reads

                  Here is a read from my read1 fastq:

                  @VL00773:6:AAFVNLMM5:1:1101:21412:1000:CTGGTGGTT 1:N:0:ACTCTCGA+CTGTACCA
                  GTGGGCACTAGCATACTTCCCAAGCTTGGGGTAGGGCAATATAGGCAAGTCGATCAAGCTTGCAGCTGACTCCCTTTGGGATCTTGGGCTTAACCTCCTTGGGCTTTACGAGGGCCTCGATAGCCTTGGCACGTGCACTCATGGCCTTGGC
                  +
                  CCCCCCCCCCCCCCCCCCCCCCC;CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CCCC;CCCCCCCCCCCCCCCCCCCCCCCC​

                  if I remove the :CTGGTGGTT from the end of the header I can use clumpify

                  but with it there it just fails:


                  clumpify.sh in1=sample1_R1_001.fastq.gz in2=sample1_R2_001.fastq.gz out1=sample1_dedup_R1_001.fastq.gz out
                  2=sample1_dedup_R2_001.fastq.gz dedupe=t optical=t dupedist=40 spany=t t=1 -Xmx100g -Xms100g

                  openjdk version "1.8.0_112"
                  OpenJDK Runtime Environment (Zulu 8.19.0.1-linux64) (build 1.8.0_112-b16)
                  OpenJDK 64-Bit Server VM (Zulu 8.19.0.1-linux64) (build 25.112-b16, mixed mode)
                  java -ea -Xmx100g -Xms100g -cp .../bbtools/lib/current/ clump.Clumpify in1=sample1_R1_001.fastq.gz in2=sample1_R2_001.fastq.gz out1=sample1_dedup_R1_001.fastq.gz out out2=sample1_dedup_R2_001.fastq.gz out dedupe=t optical=t dupedist=40 spany=t t=1 -Xmx100g -Xms100g
                  Executing clump.Clumpify [in1=sample1_R1_001.fastq.gz, in2=sample1_R2_001.fastq.gz, out1=sample1_dedup_R1_001.fastq.gz, out
                  2=sample1_dedup_R2_001.fastq.gz​, dedupe=t, optical=t, dupedist=40, spany=t, t=1, -Xmx100g, -Xms100g]


                  Clumpify version 37.62
                  Read Estimate: 21805466
                  Memory Estimate: 16636 MB
                  Memory Available: 80430 MB
                  Set groups to 1
                  Executing clump.KmerSort [in1=sample1_R1_001.fastq.gz, in2=sample1_R2_001.fastq.gz, out1=sample1_dedup_R1_001.fastq.gz, out
                  2=sample1_dedup_R2_001.fastq.gz​, groups=1, ecco=false, rename=false, shortname=f, unpair=false, repair=false, namesort=false, ow=true, dedupe=t, t=1, -Xmx100g, -Xms100g]

                  Set threads to 1
                  Making comparator.
                  Made a comparator with k=31, seed=1, border=1, hashes=4
                  Starting cris 0.
                  Fetching reads.
                  Making fetch threads.
                  Starting threads.
                  Waiting for threads.
                  Exception in thread "Thread-3" java.lang.AssertionError: VL00773:7:AAFYLV7M5:1:1101:18648:1000:TAACCCATC 1:N:0:ACTCCATC+GATCAAGG
                  at hiseq.FlowcellCoordinate.setFrom(FlowcellCoordinate.java:92)
                  at clump.ReadKey.<init>(ReadKey.java:46)
                  at clump.ReadKey.<init>(ReadKey.java:33)
                  at clump.ReadKey.makeKey(ReadKey.java:23)
                  at clump.KmerComparator.hash(KmerComparator.java:73)
                  at clump.KmerComparator.hash(KmerComparator.java:66)
                  at clump.KmerSort$FetchThread.run(KmerSort.java:816)
                  Fetch time: 0.076 seconds.
                  Closing input stream.
                  Combining thread output.
                  Combine time: 0.000 seconds.
                  Exception in thread "main" java.lang.AssertionError: 0, 400, true
                  at clump.KmerSort.fetchReads(KmerSort.java:718)
                  at clump.KmerSort.processInner(KmerSort.java:400)
                  at clump.KmerSort.process(KmerSort.java:320)
                  at clump.KmerSort.main(KmerSort.java:51)
                  at clump.Clumpify.process(Clumpify.java:247)
                  at clump.Clumpify.main(Clumpify.java:37)




                  Anyone has any solution to make this work without having to loose all my UMI information?

                  Comment

                  • GenoMax
                    Senior Member
                    • Feb 2008
                    • 7142

                    Originally posted by duartemolha View Post
                    I am having problems using clumpify with my fastqs and I beleive it is related to the UMI on the header of the fastq reads

                    Here is a read from my read1 fastq:

                    @VL00773:6:AAFVNLMM5:1:1101:21412:1000:CTGGTGGTT 1:N:0:ACTCTCGA+CTGTACCA
                    GTGGGCACTAGCATACTTCCCAAGCTTGGGGTAGGGCAATATAGGCAAGTCGATCAAGCTTGCAGCTGACTCCCTTTGGGATCTTGGGCTTAACCTCCTTGGGCTTTACGAGGGCCTCGATAGCCTTGGCACGTGCACTCATGGCCTTGGC
                    +
                    CCCCCCCCCCCCCCCCCCCCCCC;CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CCCC;CCCCCCCCCCCCCCCCCCCCCCCC​

                    if I remove the :CTGGTGGTT from the end of the header I can use clumpify

                    but with it there it just fails:


                    clumpify.sh in1=sample1_R1_001.fastq.gz in2=sample1_R2_001.fastq.gz out1=sample1_dedup_R1_001.fastq.gz out
                    2=sample1_dedup_R2_001.fastq.gz dedupe=t optical=t dupedist=40 spany=t t=1 -Xmx100g -Xms100g

                    openjdk version "1.8.0_112"
                    OpenJDK Runtime Environment (Zulu 8.19.0.1-linux64) (build 1.8.0_112-b16)
                    OpenJDK 64-Bit Server VM (Zulu 8.19.0.1-linux64) (build 25.112-b16, mixed mode)
                    java -ea -Xmx100g -Xms100g -cp .../bbtools/lib/current/ clump.Clumpify in1=sample1_R1_001.fastq.gz in2=sample1_R2_001.fastq.gz out1=sample1_dedup_R1_001.fastq.gz out out2=sample1_dedup_R2_001.fastq.gz out dedupe=t optical=t dupedist=40 spany=t t=1 -Xmx100g -Xms100g
                    Executing clump.Clumpify [in1=sample1_R1_001.fastq.gz, in2=sample1_R2_001.fastq.gz, out1=sample1_dedup_R1_001.fastq.gz, out
                    2=sample1_dedup_R2_001.fastq.gz​, dedupe=t, optical=t, dupedist=40, spany=t, t=1, -Xmx100g, -Xms100g]


                    Clumpify version 37.62
                    Read Estimate: 21805466
                    Memory Estimate: 16636 MB
                    Memory Available: 80430 MB
                    Set groups to 1
                    Executing clump.KmerSort [in1=sample1_R1_001.fastq.gz, in2=sample1_R2_001.fastq.gz, out1=sample1_dedup_R1_001.fastq.gz, out
                    2=sample1_dedup_R2_001.fastq.gz​, groups=1, ecco=false, rename=false, shortname=f, unpair=false, repair=false, namesort=false, ow=true, dedupe=t, t=1, -Xmx100g, -Xms100g]

                    Set threads to 1
                    Making comparator.
                    Made a comparator with k=31, seed=1, border=1, hashes=4
                    Starting cris 0.
                    Fetching reads.
                    Making fetch threads.
                    Starting threads.
                    Waiting for threads.
                    Exception in thread "Thread-3" java.lang.AssertionError: VL00773:7:AAFYLV7M5:1:1101:18648:1000:TAACCCATC 1:N:0:ACTCCATC+GATCAAGG
                    at hiseq.FlowcellCoordinate.setFrom(FlowcellCoordinate.java:92)
                    at clump.ReadKey.<init>(ReadKey.java:46)
                    at clump.ReadKey.<init>(ReadKey.java:33)
                    at clump.ReadKey.makeKey(ReadKey.java:23)
                    at clump.KmerComparator.hash(KmerComparator.java:73)
                    at clump.KmerComparator.hash(KmerComparator.java:66)
                    at clump.KmerSort$FetchThread.run(KmerSort.java:816)
                    Fetch time: 0.076 seconds.
                    Closing input stream.
                    Combining thread output.
                    Combine time: 0.000 seconds.
                    Exception in thread "main" java.lang.AssertionError: 0, 400, true
                    at clump.KmerSort.fetchReads(KmerSort.java:718)
                    at clump.KmerSort.processInner(KmerSort.java:400)
                    at clump.KmerSort.process(KmerSort.java:320)
                    at clump.KmerSort.main(KmerSort.java:51)
                    at clump.Clumpify.process(Clumpify.java:247)
                    at clump.Clumpify.main(Clumpify.java:37)




                    Anyone has any solution to make this work without having to loose all my UMI information?
                    I just did a brief test with the sample you included above. I did not have an issue with using clumpify with a couple of reads. So likely the issue lies someplace else and not in the UMI,

                    Comment

                    Latest Articles

                    Collapse

                    • SEQadmin2
                      From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                      by SEQadmin2


                      Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                      The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                      ...
                      06-02-2026, 10:05 AM
                    • SEQadmin2
                      Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
                      by SEQadmin2


                      With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


                      Introduction

                      Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
                      05-22-2026, 06:42 AM
                    • SEQadmin2
                      Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
                      by SEQadmin2

                      Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


                      Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
                      05-06-2026, 09:04 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, Yesterday, 08:59 AM
                    0 responses
                    14 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 06-02-2026, 12:03 PM
                    0 responses
                    22 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 06-02-2026, 11:40 AM
                    0 responses
                    19 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 05-28-2026, 11:40 AM
                    0 responses
                    32 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...