Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bambus .mate file

    Hi,

    I'm trying to scaffold velvet output of a de novo assembly of Illumina paired-end data using Bambus. But velvet only output one contigs.fa file, which doesn't contain any pairing information, see below:

    >NODE_76_length_102_cov_26.774509
    AACTTACCAGGTTCATATCGGATCGAGTTGACCCTTCCGTGAGTCAAAGTATTCCATGCG
    CTTCTCAAGCGAAGCTTCAATAAGCTGAGCGTAACTGGGAAGTATGCTTCATCGTTTGTT
    TCCAGTGCTT

    I can generate .contig file from it, but how can I generate .mate file? Using AMOS tools, I only get one line in .mate file, see below:

    library 1 210 390

    Which can't generate any scaffolding. Do I need to include original Illumina files that contains short reads as second library to get mate informations?

    I'm new to this field and this is my first project. I would really appreciate any help! Thanks a lot in advance!

  • #2
    Originally posted by bye View Post
    I'm trying to scaffold velvet output of a de novo assembly of Illumina paired-end data using Bambus. But velvet only output one contigs.fa file, which doesn't contain any pairing information, see below:
    FYI - Velvet can do scaffolding for you when you assemble using paired-end reads. You may already be using it without realising it?

    Comment


    • #3
      Originally posted by bye View Post
      Hi,

      I'm trying to scaffold velvet output of a de novo assembly of Illumina paired-end data using Bambus. But velvet only output one contigs.fa file, which doesn't contain any pairing information, see below:

      >NODE_76_length_102_cov_26.774509
      AACTTACCAGGTTCATATCGGATCGAGTTGACCCTTCCGTGAGTCAAAGTATTCCATGCG
      CTTCTCAAGCGAAGCTTCAATAAGCTGAGCGTAACTGGGAAGTATGCTTCATCGTTTGTT
      TCCAGTGCTT

      I can generate .contig file from it, but how can I generate .mate file? Using AMOS tools, I only get one line in .mate file, see below:

      library 1 210 390

      Which can't generate any scaffolding. Do I need to include original Illumina files that contains short reads as second library to get mate informations?

      I'm new to this field and this is my first project. I would really appreciate any help! Thanks a lot in advance!
      Hi,
      I am also facing the same problem. Did you generate the mate files or not yet. Please share your experience.
      cheers,
      Rahul
      Rahul Sharma,
      Ph.D
      Frankfurt am Main, Germany

      Comment


      • #4
        Sorry can't help you, I gave up finally. Using CLC workbench instead.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM
        • seqadmin
          Strategies for Sequencing Challenging Samples
          by seqadmin


          Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
          03-22-2024, 06:39 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        18 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        22 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-04-2024, 09:00 AM
        0 responses
        49 views
        0 likes
        Last Post seqadmin  
        Working...
        X