Hi!
I'm new on this forum and in this field of research. I've tried to find an answer to a probably very simple question, but have failed. So I try here and see where I end up?
I have paired end data for small RNA (sequenced on NextSeq500, library based on NEXTflex Small RNA-kit (Illumina compatible)). I realise most people have single end data, not paired end data for small RNAs. So I have problems with the adapter trimming. It's probably obvious how to handle that, but I'm new and I struggle...
I've used cutadapt, as recommended by Bioo Scientific, which works fine for R1, but not R2. I obviously don't understand which sequence I need to state for the adapter for the second read. Coz I had expected both R1 and R2 to be processed at more or less the same level since its so short reads? Any help?
This is an example from when I ran the script, in this case I had stated the reverse complement for the adapter in the code above. I have also tried what results I get if I trim away the 5' adapter (but with the -g option instead) and don't get any wiser from that. *feel stupid*
Total read pairs processed: 8,827,513
Read 1 with adapter: 8,362,506 (94.7%)
Read 2 with adapter: 45,734 (0.5%)
Pairs that were too short: 91,927 (1.0%)
Pairs written (passing filters): 8,735,586 (99.0%)
Total basepairs processed: 1,341,781,976 bp
Read 1: 670,890,988 bp
Read 2: 670,890,988 bp
Total written (filtered): 950,264,383 bp (70.8%)
Read 1: 286,493,104 bp
Read 2: 663,771,279 bp
I appreciate any help and/or suggestions?
//Åsa
I'm new on this forum and in this field of research. I've tried to find an answer to a probably very simple question, but have failed. So I try here and see where I end up?
I have paired end data for small RNA (sequenced on NextSeq500, library based on NEXTflex Small RNA-kit (Illumina compatible)). I realise most people have single end data, not paired end data for small RNAs. So I have problems with the adapter trimming. It's probably obvious how to handle that, but I'm new and I struggle...
I've used cutadapt, as recommended by Bioo Scientific, which works fine for R1, but not R2. I obviously don't understand which sequence I need to state for the adapter for the second read. Coz I had expected both R1 and R2 to be processed at more or less the same level since its so short reads? Any help?
Code:
cutadapt -a TGGAATTCTCGGGTGCCAAGG -A <adapter???> -o /proj/Trimming/B1_trimmed1_fwd.fq -p /proj/Trimming/B1_trimmed1_rev.fq --minimum-length 23 /proj/FastQ/B1_fwd.fastq.gz /proj/FastQ/B1_rev.fastq.gz
Total read pairs processed: 8,827,513
Read 1 with adapter: 8,362,506 (94.7%)
Read 2 with adapter: 45,734 (0.5%)
Pairs that were too short: 91,927 (1.0%)
Pairs written (passing filters): 8,735,586 (99.0%)
Total basepairs processed: 1,341,781,976 bp
Read 1: 670,890,988 bp
Read 2: 670,890,988 bp
Total written (filtered): 950,264,383 bp (70.8%)
Read 1: 286,493,104 bp
Read 2: 663,771,279 bp
I appreciate any help and/or suggestions?
//Åsa
Comment