Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • phylip to fasta

    Hi,

    Can anyone provide me a script in python or perl that converts phylip interleaved into fasta? I already found some scripts but it seems that they all work with phylip sequential and not with interleaved.

    Thanks a lot!!

  • #2
    What a coincidence, I have a script which does just that in the BBMap package!

    Code:
    phylip2fasta.sh in=file.phylip out=file.fasta

    Comment


    • #3
      Thanks so much!

      I already saw that there are others useful scripts in bbmap.

      Comment


      • #4
        Originally posted by Brian Bushnell View Post
        What a coincidence, I have a script which does just that in the BBMap package!

        Code:
        phylip2fasta.sh in=file.phylip out=file.fasta
        Sorry Brian, but seems that your script does not work well with my files. Can you tell me why?

        For example:
        file.phy
        3 120
        seq1 ATGTGTTCAGCTCTAGTCGACAAGTATTTCAACTACCAGGAACCTCCGAATCGACAACTT
        seq2 ATGTGTTCGGCTCTTGTAGAGAGACATTTCAGCTTCATAGCGTCTTCG------------
        seq3 ATGTGTTCAGCTCTAGTCGACAAATATTTTAACTACCAGGAACCTCCTGATCGACAACAC

        CAACTTTCGTTTGAAGACTCCAAAATGGCCTACGACAACGGGTCGGACAGCCAGGGCTCG
        ------AGGTTTGAAGACTCGAGAATGGCTTACGACAACGGGTCGGACAGCCAGGGTTCG
        CAGCTTCAATTTGAGGCCACCAAAATGGCCTACGACAACGGCTCAGATAGCCAAGGCTCC

        file.fas
        >seq1
        ATGTGTTCAGCTCTAGTCGACAAGTATTTCAACTACCAGGAACCTCCGAATCGACAACTT
        >seq2
        ATGTGTTCGGCTCTTGTAGAGAGACATTTCAGCTTCATAGCGTCTTCG
        >seq3
        ATGTGTTCAGCTCTAGTCGACAAATATTTTAACTACCAGGAACCTCCTGATCGACAACAC
        >CAACTTTCGTTTGAAGACTCCAAAATGGCCTACGACAACGGGTCGGACAGCCAGGGCTCG

        >------AGGTTTGAAGACTCGAGAATGGCTTACGACAACGGGTCGGACAGCCAGGGTTCG

        >CAGCTTCAATTTGAGGCCACCAAAATGGCCTACGACAACGGCTCAGATAGCCAAGGCTCC

        Comment


        • #5
          I only had a chance to try it on one file, and it worked fine in that case, but that's not a very robust test... can you send me the file you're using?

          What you have posted might be enough to replicate the problem, but to ensure it works correctly in entirety, the full file is probably essential.

          Comment


          • #6
            If you haven't already found a solution, I've got a simple script that can interconvert between any of the formats supported in BioPerl's Bio::AlignIO, which you'd need to have installed. For Phylip to Fasta:

            Code:
            convertAlignment.pl -if phylip -of fasta < file.phy > file.fa
            It's available in my bioinfo/scripts repository.

            Comment


            • #7
              Originally posted by Brian Bushnell View Post
              I only had a chance to try it on one file, and it worked fine in that case, but that's not a very robust test... can you send me the file you're using?

              What you have posted might be enough to replicate the problem, but to ensure it works correctly in entirety, the full file is probably essential.

              Sorry for the late reply.
              You can find my files attached, but I changed the fasta and phylip to .txt because is impossible to attach files with that extensions.
              Attached Files

              Comment

              Latest Articles

              Collapse

              • seqadmin
                The Impact of AI in Genomic Medicine
                by seqadmin



                Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
                Yesterday, 02:07 PM
              • seqadmin
                Multiomics Techniques Advancing Disease Research
                by seqadmin


                New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

                A major leap in the field has
                ...
                02-08-2024, 06:33 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 02-23-2024, 04:11 PM
              0 responses
              44 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-21-2024, 08:52 AM
              0 responses
              60 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-20-2024, 08:57 AM
              0 responses
              51 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-14-2024, 09:19 AM
              0 responses
              65 views
              0 likes
              Last Post seqadmin  
              Working...
              X