Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ac91
    replied
    Originally posted by Brian Bushnell View Post
    I only had a chance to try it on one file, and it worked fine in that case, but that's not a very robust test... can you send me the file you're using?

    What you have posted might be enough to replicate the problem, but to ensure it works correctly in entirety, the full file is probably essential.

    Sorry for the late reply.
    You can find my files attached, but I changed the fasta and phylip to .txt because is impossible to attach files with that extensions.
    Attached Files

    Leave a comment:


  • dgscofield
    replied
    If you haven't already found a solution, I've got a simple script that can interconvert between any of the formats supported in BioPerl's Bio::AlignIO, which you'd need to have installed. For Phylip to Fasta:

    Code:
    convertAlignment.pl -if phylip -of fasta < file.phy > file.fa
    It's available in my bioinfo/scripts repository.

    Leave a comment:


  • Brian Bushnell
    replied
    I only had a chance to try it on one file, and it worked fine in that case, but that's not a very robust test... can you send me the file you're using?

    What you have posted might be enough to replicate the problem, but to ensure it works correctly in entirety, the full file is probably essential.

    Leave a comment:


  • ac91
    replied
    Originally posted by Brian Bushnell View Post
    What a coincidence, I have a script which does just that in the BBMap package!

    Code:
    phylip2fasta.sh in=file.phylip out=file.fasta
    Sorry Brian, but seems that your script does not work well with my files. Can you tell me why?

    For example:
    file.phy
    3 120
    seq1 ATGTGTTCAGCTCTAGTCGACAAGTATTTCAACTACCAGGAACCTCCGAATCGACAACTT
    seq2 ATGTGTTCGGCTCTTGTAGAGAGACATTTCAGCTTCATAGCGTCTTCG------------
    seq3 ATGTGTTCAGCTCTAGTCGACAAATATTTTAACTACCAGGAACCTCCTGATCGACAACAC

    CAACTTTCGTTTGAAGACTCCAAAATGGCCTACGACAACGGGTCGGACAGCCAGGGCTCG
    ------AGGTTTGAAGACTCGAGAATGGCTTACGACAACGGGTCGGACAGCCAGGGTTCG
    CAGCTTCAATTTGAGGCCACCAAAATGGCCTACGACAACGGCTCAGATAGCCAAGGCTCC

    file.fas
    >seq1
    ATGTGTTCAGCTCTAGTCGACAAGTATTTCAACTACCAGGAACCTCCGAATCGACAACTT
    >seq2
    ATGTGTTCGGCTCTTGTAGAGAGACATTTCAGCTTCATAGCGTCTTCG
    >seq3
    ATGTGTTCAGCTCTAGTCGACAAATATTTTAACTACCAGGAACCTCCTGATCGACAACAC
    >CAACTTTCGTTTGAAGACTCCAAAATGGCCTACGACAACGGGTCGGACAGCCAGGGCTCG

    >------AGGTTTGAAGACTCGAGAATGGCTTACGACAACGGGTCGGACAGCCAGGGTTCG

    >CAGCTTCAATTTGAGGCCACCAAAATGGCCTACGACAACGGCTCAGATAGCCAAGGCTCC

    Leave a comment:


  • ac91
    replied
    Thanks so much!

    I already saw that there are others useful scripts in bbmap.

    Leave a comment:


  • Brian Bushnell
    replied
    What a coincidence, I have a script which does just that in the BBMap package!

    Code:
    phylip2fasta.sh in=file.phylip out=file.fasta

    Leave a comment:


  • ac91
    started a topic phylip to fasta

    phylip to fasta

    Hi,

    Can anyone provide me a script in python or perl that converts phylip interleaved into fasta? I already found some scripts but it seems that they all work with phylip sequential and not with interleaved.

    Thanks a lot!!

Latest Articles

Collapse

  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin



    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    Yesterday, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
45 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
61 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
51 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
65 views
0 likes
Last Post seqadmin  
Working...
X