[drio]

Could someone help to compile SAMtool?

See the errors:
make[1]: Entering directory `/home/jta/biosoft/samtools-0.1.7a'
gcc -c -g -Wall -O2 -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE -D_CURSES_LIB=1 bam_tview.c -o bam_tview.o
bam_tview.c:5:20: error: curses.h: No such file or directory
bam_tview.c:7:2: warning: #warning "_CURSES_LIB=1 but NCURSES_VERSION not defined; tview is NOT compiled"
bam_tview.c:409:2: warning: #warning "No curses library is available; tview is disabled."
make[1]: *** [bam_tview.o] Error 1
make[1]: Leaving directory `/home/jta/biosoft/samtools-0.1.7a'
make: *** [all-recur] Error 1
***************
It showed missing curses.h file. where is it?

Thanks a lot.

The ncurses library is not installed in your system.
Fire up your package manager and install the ncurses-lib package.

[NSTbioinformatics]

Could someone help to compile SAMtool?

See the errors:
make[1]: Entering directory `/home/jta/biosoft/samtools-0.1.7a'
gcc -c -g -Wall -O2 -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE -D_CURSES_LIB=1 bam_tview.c -o bam_tview.o
bam_tview.c:5:20: error: curses.h: No such file or directory
bam_tview.c:7:2: warning: #warning "_CURSES_LIB=1 but NCURSES_VERSION not defined; tview is NOT compiled"
bam_tview.c:409:2: warning: #warning "No curses library is available; tview is disabled."
make[1]: *** [bam_tview.o] Error 1
make[1]: Leaving directory `/home/jta/biosoft/samtools-0.1.7a'
make: *** [all-recur] Error 1
***************
It showed missing curses.h file. where is it?

Thanks a lot.

[NSTbioinformatics]

I am wondering how you can use SAMtool to convert ELAND alignment file s_N_sorted.txt or S_N_export.txt.
I did not find a way to do it in the manual of SAMtool.

[kjngo]

I also got the following error while producing the SAM file

GAGACTNAGCACNCAACGGA -",883&,,:#/1-"6&2)-":#6=67*#9,9&/0&3)-"3+=4<-"&5
/mnt/scratch/awadalla/czuldieg/392Tmod/sources/I392T:35_18_1596 4 * 0 0 * * 0 0 NCCGGCATAGCTNTACCNTTAGACATAGCTCCGTCNCAGACNAACCCCA -"6;:<9>7=5<$-"4?>5-"67:&5=;8&6/0=2.7=-"37*3=-"1:
[bns_coor_pac2real] bug! Coordinate is longer than sequence (4294967295>=4929). Abort!
Aborted

hi luisczul,
I ran into the same problem. I was wondering how you fixed this?

[sunyu1357]

consensus missing NNNN... in the end

This may be a quite minor issue in samtools.pl pileup2mq. The consensus sequence extracted from pileup file lost a string of NNNN... in the end, so it will make the consensus sequence a little bit shorter in length compare to reference. All the other gaps, including the beginning NNN..., were including in the consensus, but not for the last one.

As far as I know, it seems to be that in the sort process, all the gaps information was not written in the sorted file. But in the samtools.pl script, Heng tried to put the gapped seq back to the consensus. All the gaps was placed in the right position, except for the ending one.

BTW, I really like the idea of SAM format and the SamTools. It is a really good format manipulator for the bioinformatic community

[lh3]

1) Count how many reads mapped with non-zero mapping quality. X0 tag is not always reliable.

2) AS tag is optional and bwa sampe/se does not produce this tag. See "NM" for number of mismatches/gaps.

[fabio.marroni]

Number of best hits in BWA alignment

We are using BWA to perform short-reads alignments, and we have two queries.
1) We are wondering how to extract statistics on the number of best hits for a read from the alignment file, in particular we are interested in counting "uniquely mapped reads".
In the BWA manual page (http://bio-bwa.sourceforge.net/bwa.shtml), it seems that the field "X0" contains the number of best hits, but it happens that some mapped reads do not have a "X0" field (see the attached file).

2) In the manual page, we also read about alignment score (field "AS"), but we found no "AS" field in the output file.

Commands used to generate alignment were:
bwa aln -q 34 Populus_trichocarpa.v2.fa s_1_1_sequence.txt > s_1_1_sequence_q34.sai

bwa aln -q 34 Populus_trichocarpa.v2.fa s_1_2_sequence.txt > s_1_2_sequence_q34.sai
bwa sampe Populus_trichocarpa.v2.fa s_1_1_sequence_q34.sai s_1_2_sequence_q34.sai s_1_1_sequence.txt s_1_2_sequence.txt > s_1_sequence_q34.sam

Thank you for your help

[bair]

Hi Ih3,

When samtools merges two sorted bam file, it sorts the merged file itself or have to sort again?

Based on the example, if merge three bam files, a file with three header lines (even they are the same) has to be generated before?

What's the difference between maq SNPfilter and samtools varFilter?

Thanks

[NGSfan]

Another issue I found is after doing a sort:

samtools sort aln.bam aln.sorted

samtools view -H aln.sorted.bam

The header SO: field remains unsorted

@HD VN:1.0 SO:unsorted


I have to use picard's sorter to get a header with SO:sorted.

programs such as GATK complain when this header is not changed.

Ok, there is a solution to this problem:

http://www.broadinstitute.org/gsa/wiki/index.php/Sort_Order_Tag_Fixer

"BAM files created by samtools which are sorted often don't have the sort order set to 'coordinate' in the BAM header (instead it's marked as 'unsorted'. Because BAMs are binary files, there's no way to easily change the tag. This walker rewrites a BAM file so that the output is identical to the input except that the sort order tag is set to 'coordinate'. "

[ikrier]

I wished to convert a recent eland export alignment file to use for QuEST analysis. Does the export2sam.pl script work for the 1.3+ versions? Is there any format converter that can convert this type of file around?

[polivares]

Hi,

I am trying to find a script able to convert from a output file from the solexa pipeline called 'realign' ( page 9 ) into SAM format. I will keep my search, but in the meantime I thought someone may know about it in this thread.

Or maybe there is a different (better) way of doing this before I write a parser.

The format I goes like this :
TACCATATTTATATTACATTAAATTCCTATATTTAC 14859 1 hs_ref_chr14:21265482 F TACCATATTTATAGTACATTAAATTCCTAGATATAC 14859

where each column means :

sequence

best score

numbers of hits at that score

target: pos

strand

target sequence

next best score

Thank you !

[NGSfan]

Another issue I found is after doing a sort:

samtools sort aln.bam aln.sorted

samtools view -H aln.sorted.bam

The header SO: field remains unsorted

@HD VN:1.0 SO:unsorted


I have to use picard's sorter to get a header with SO:sorted.

programs such as GATK complain when this header is not changed.

[NGSfan]

coordinates off in samtools tview

First, I just want to thank the author of samtools - it is a great package for the community. I especially appreciate the streaming abilities.

I have a odd problem when I use samtools tview to visualize my alignments.

I have found that the coordinates are completely off ! For example if I use this command:

samtools tview my.bowtie.sorted.bam hg18.fa

and I go to chr22, I find that the position of the visualized read alignment is more than 100kb off than the reported read position in the sam output ! However, when I look at chrM, I find the coordinates to work just fine. All chromosomes except chrM have this problem. Is this an fasta indexing issue? I have also separated out the individual chromosome reference sequence and indexed that by itself, but I still get the same problem! If indexing were a problem, then that should have solved it, no?

I know I am using the same reference fa that I used to build the search index in bowtie. I converted my sam to bam, then sorted, and indexed. I don't know what is going on here. Has anyone experienced this? Is there something I am overlooking?

Thank you for reading this and thank you for any help/suggestions.

[Richard Finney]

hg18 --> hg19 bam conversion program ???

Anybody written the great hg18 --> hg19 bam conversion program, yet?

I mean in "C", not perl or ruby (just kidding, as long as it finishes by 8:00 AM)

[gengen]

question about scores of INDEL in pileup output file

I have a question about output file of pileup command.

According to samtools FAQ pagehttp://sourceforge.net/apps/mediawik...pileup_output., column 5 is phred-scaled consensus score and column 6 is phred-scaled SNP score.

For SNP line, it seems to be true that it is phred-scaled.
But for INDEL line, values in column 5,6 seem too large to be phred-scaled. In my pileup output file, these values (column 5, 6 of INDEL line) are larger than 1000 very often. (sometimes larger than 4000.)

Please let me know how these values (column 5,6 of INDEL line) are calculated.

thanks in advance