Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • drio
    replied
    Originally posted by NSTbioinformatics View Post
    Could someone help to compile SAMtool?

    See the errors:
    make[1]: Entering directory `/home/jta/biosoft/samtools-0.1.7a'
    gcc -c -g -Wall -O2 -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE -D_CURSES_LIB=1 bam_tview.c -o bam_tview.o
    bam_tview.c:5:20: error: curses.h: No such file or directory
    bam_tview.c:7:2: warning: #warning "_CURSES_LIB=1 but NCURSES_VERSION not defined; tview is NOT compiled"
    bam_tview.c:409:2: warning: #warning "No curses library is available; tview is disabled."
    make[1]: *** [bam_tview.o] Error 1
    make[1]: Leaving directory `/home/jta/biosoft/samtools-0.1.7a'
    make: *** [all-recur] Error 1
    ***************
    It showed missing curses.h file. where is it?

    Thanks a lot.
    The ncurses library is not installed in your system.
    Fire up your package manager and install the ncurses-lib package.

    Leave a comment:


  • NSTbioinformatics
    replied
    Could someone help to compile SAMtool?

    See the errors:
    make[1]: Entering directory `/home/jta/biosoft/samtools-0.1.7a'
    gcc -c -g -Wall -O2 -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE -D_CURSES_LIB=1 bam_tview.c -o bam_tview.o
    bam_tview.c:5:20: error: curses.h: No such file or directory
    bam_tview.c:7:2: warning: #warning "_CURSES_LIB=1 but NCURSES_VERSION not defined; tview is NOT compiled"
    bam_tview.c:409:2: warning: #warning "No curses library is available; tview is disabled."
    make[1]: *** [bam_tview.o] Error 1
    make[1]: Leaving directory `/home/jta/biosoft/samtools-0.1.7a'
    make: *** [all-recur] Error 1
    ***************
    It showed missing curses.h file. where is it?

    Thanks a lot.

    Leave a comment:


  • NSTbioinformatics
    replied
    I am wondering how you can use SAMtool to convert ELAND alignment file s_N_sorted.txt or S_N_export.txt.
    I did not find a way to do it in the manual of SAMtool.

    Leave a comment:


  • kjngo
    replied
    Originally posted by luisczul View Post
    I also got the following error while producing the SAM file

    GAGACTNAGCACNCAACGGA -",883&,,:#/1-"6&2)-":#6=67*#9,9&/0&3)-"3+=4<-"&5
    /mnt/scratch/awadalla/czuldieg/392Tmod/sources/I392T:35_18_1596 4 * 0 0 * * 0 0 NCCGGCATAGCTNTACCNTTAGACATAGCTCCGTCNCAGACNAACCCCA -"6;:<9>7=5<$-"4?>5-"67:&5=;8&6/0=2.7=-"37*3=-"1:
    [bns_coor_pac2real] bug! Coordinate is longer than sequence (4294967295>=4929). Abort!
    Aborted
    hi luisczul,
    I ran into the same problem. I was wondering how you fixed this?

    Leave a comment:


  • sunyu1357
    replied
    consensus missing NNNN... in the end

    This may be a quite minor issue in samtools.pl pileup2mq. The consensus sequence extracted from pileup file lost a string of NNNN... in the end, so it will make the consensus sequence a little bit shorter in length compare to reference. All the other gaps, including the beginning NNN..., were including in the consensus, but not for the last one.

    As far as I know, it seems to be that in the sort process, all the gaps information was not written in the sorted file. But in the samtools.pl script, Heng tried to put the gapped seq back to the consensus. All the gaps was placed in the right position, except for the ending one.

    BTW, I really like the idea of SAM format and the SamTools. It is a really good format manipulator for the bioinformatic community

    Leave a comment:


  • lh3
    replied
    1) Count how many reads mapped with non-zero mapping quality. X0 tag is not always reliable.

    2) AS tag is optional and bwa sampe/se does not produce this tag. See "NM" for number of mismatches/gaps.

    Leave a comment:


  • fabio.marroni
    replied
    Number of best hits in BWA alignment

    We are using BWA to perform short-reads alignments, and we have two queries.
    1) We are wondering how to extract statistics on the number of best hits for a read from the alignment file, in particular we are interested in counting "uniquely mapped reads".
    In the BWA manual page (http://bio-bwa.sourceforge.net/bwa.shtml), it seems that the field "X0" contains the number of best hits, but it happens that some mapped reads do not have a "X0" field (see the attached file).

    2) In the manual page, we also read about alignment score (field "AS"), but we found no "AS" field in the output file.

    Commands used to generate alignment were:
    bwa aln -q 34 Populus_trichocarpa.v2.fa s_1_1_sequence.txt > s_1_1_sequence_q34.sai

    bwa aln -q 34 Populus_trichocarpa.v2.fa s_1_2_sequence.txt > s_1_2_sequence_q34.sai
    bwa sampe Populus_trichocarpa.v2.fa s_1_1_sequence_q34.sai s_1_2_sequence_q34.sai s_1_1_sequence.txt s_1_2_sequence.txt > s_1_sequence_q34.sam

    Thank you for your help

    Leave a comment:


  • bair
    replied
    Hi Ih3,

    When samtools merges two sorted bam file, it sorts the merged file itself or have to sort again?

    Based on the example, if merge three bam files, a file with three header lines (even they are the same) has to be generated before?

    What's the difference between maq SNPfilter and samtools varFilter?

    Thanks

    Leave a comment:


  • NGSfan
    replied
    Originally posted by NGSfan View Post
    Another issue I found is after doing a sort:

    samtools sort aln.bam aln.sorted

    samtools view -H aln.sorted.bam

    The header SO: field remains unsorted

    @HD VN:1.0 SO:unsorted


    I have to use picard's sorter to get a header with SO:sorted.

    programs such as GATK complain when this header is not changed.

    Ok, there is a solution to this problem:

    http://www.broadinstitute.org/gsa/wi...rder_Tag_Fixer

    "BAM files created by samtools which are sorted often don't have the sort order set to 'coordinate' in the BAM header (instead it's marked as 'unsorted'. Because BAMs are binary files, there's no way to easily change the tag. This walker rewrites a BAM file so that the output is identical to the input except that the sort order tag is set to 'coordinate'. "

    Leave a comment:


  • ikrier
    replied
    I wished to convert a recent eland export alignment file to use for QuEST analysis. Does the export2sam.pl script work for the 1.3+ versions? Is there any format converter that can convert this type of file around?

    Leave a comment:


  • polivares
    replied
    Hi,

    I am trying to find a script able to convert from a output file from the solexa pipeline called 'realign' ( page 9 ) into SAM format. I will keep my search, but in the meantime I thought someone may know about it in this thread.

    Or maybe there is a different (better) way of doing this before I write a parser.

    The format I goes like this :
    TACCATATTTATATTACATTAAATTCCTATATTTAC 14859 1 hs_ref_chr14:21265482 F TACCATATTTATAGTACATTAAATTCCTAGATATAC 14859

    where each column means :

    sequence

    best score

    numbers of hits at that score

    target: pos

    strand

    target sequence

    next best score

    Thank you !
    Last edited by polivares; 01-14-2010, 08:33 AM.

    Leave a comment:


  • NGSfan
    replied
    Another issue I found is after doing a sort:

    samtools sort aln.bam aln.sorted

    samtools view -H aln.sorted.bam

    The header SO: field remains unsorted

    @HD VN:1.0 SO:unsorted


    I have to use picard's sorter to get a header with SO:sorted.

    programs such as GATK complain when this header is not changed.

    Leave a comment:


  • NGSfan
    replied
    coordinates off in samtools tview

    First, I just want to thank the author of samtools - it is a great package for the community. I especially appreciate the streaming abilities.

    I have a odd problem when I use samtools tview to visualize my alignments.

    I have found that the coordinates are completely off ! For example if I use this command:

    samtools tview my.bowtie.sorted.bam hg18.fa

    and I go to chr22, I find that the position of the visualized read alignment is more than 100kb off than the reported read position in the sam output ! However, when I look at chrM, I find the coordinates to work just fine. All chromosomes except chrM have this problem. Is this an fasta indexing issue? I have also separated out the individual chromosome reference sequence and indexed that by itself, but I still get the same problem! If indexing were a problem, then that should have solved it, no?

    I know I am using the same reference fa that I used to build the search index in bowtie. I converted my sam to bam, then sorted, and indexed. I don't know what is going on here. Has anyone experienced this? Is there something I am overlooking?

    Thank you for reading this and thank you for any help/suggestions.
    Last edited by NGSfan; 01-11-2010, 01:53 AM.

    Leave a comment:


  • Richard Finney
    replied
    hg18 --> hg19 bam conversion program ???

    Anybody written the great hg18 --> hg19 bam conversion program, yet?

    I mean in "C", not perl or ruby (just kidding, as long as it finishes by 8:00 AM)

    Leave a comment:


  • gengen
    replied
    question about scores of INDEL in pileup output file

    I have a question about output file of pileup command.

    According to samtools FAQ pagehttp://sourceforge.net/apps/mediawik...pileup_output., column 5 is phred-scaled consensus score and column 6 is phred-scaled SNP score.

    For SNP line, it seems to be true that it is phred-scaled.
    But for INDEL line, values in column 5,6 seem too large to be phred-scaled. In my pileup output file, these values (column 5, 6 of INDEL line) are larger than 1000 very often. (sometimes larger than 4000.)

    Please let me know how these values (column 5,6 of INDEL line) are calculated.

    thanks in advance

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 10:35 AM
0 responses
7 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-06-2026, 07:41 AM
0 responses
25 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
45 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
48 views
0 reactions
Last Post SEQadmin2  
Working...