Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bwa output

    Hi guys

    I run bwa on my ILLUMINA reads with the following commands:

    Code:
    ./bwa aln vitis12xCHR.fasta  s_1_1_sequence.txt -e 5  -d 0 -i 0 -t 6 >s_1_1_sequence.sai
    
    
    ./bwa aln vitis12xCHR.fasta s_1_2_sequence.txt -e 5  -d 0 -i 0 -t 6 >s_1_2_sequence.sai
    
    
    followed by
    
    ./bwa sampe vitis12xCHR.fasta s_1_1_sequence.sai s_1_2_sequence.sai s_1_1_sequence.txt s_1_2_sequence.txt >s_1_bwaAlgnment.sam

    If I open the resulting sam file I get the following output:

    Code:
    ..........................................
    ILLUMINA-C3C24B_0047:3:120:18879:10724#0	141	*	0	0	**0	0	CTAGCCCTAATTAAATTTATGTGTGACAATGTGCAAAATTTAGCACATTCAACCACAAAACTTCTATGAAGAGGT	aaaa\aaaaa_aa_aaaaa\aaaa[YWWPPHNNFOWUZ[[`a]]aaaaa`Q]KY^____[X_XXR^BBBBBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:7314#0	77	*	0	0	*	*00	AATACGCCAAAAGTCTCNTCTCCTAACTNNAANTGGCAAAACTGNNGCTGAAGCTCATCCACTCCCTCTATGTCA	bbbabbbbbbbbbbb^`E``aaaaaWZXEEOODOO^]]``WWZWEDOOOONOOOOba^bbbbbbbbab[bBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:7314#0	141	*	0	0	*	*00	ATATGGCGCGTCTGCACCAGGAGAAAGTGAGAGCTTATCTGACTTGCACACTATTCGATTATCCTATAAATCCTT	bbbb`bbabbabbbbbbbbbbb`bbbbc`X^``U`Ybb_bb`aPa_b`V`a`a\]J]\_\`\^XO^[M]Ya[a_a
    ILLUMINA-C3C24B_0047:3:120:18879:10603#0	77	*	0	0	**0	0	TGTATTATGCTTATTAANGTTGATGANTNNTTNAAAGTTCTATTNNATTCAACCTTATTTCTTCCACTTTAAGCT	bbbbbbabbbbbbbb``E``[[[[[OEODDNODOONNOOONNNNDDOOOOOOOOObbbbbbbbbbbb_bb`_a^b
    ILLUMINA-C3C24B_0047:3:120:18879:10603#0	141	*	0	0	**0	0	CAAAGGCTCATTGGCCTTTTATAAGGCGTCCCAACACTATTAAAATGAGGTCAAAAGTACCAAGTCTAAATTTTC	bbbbbbbbbbbbbbbbbbbbbbb^b\J`[WFNMOO`O```abW[_a_\aa_aUT_GNKOOXWFRQ^\T\V_^^V^
    ILLUMINA-C3C24B_0047:3:120:18879:6287#0	77	*	0	0	*	*00	AACGATTATGATAACGGNAAAGGTAANANNAANGGTAATGATGANNGTAACAGTCACGGTCACAGTAATAGTGAC	bbbbbbbbbbbbbbbaaEaaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:6287#0	141	*	0	0	*	*00	CAGTTACCGTTACCGTCAATATAAACGTTACTATCACCGTTACCGTTATCGTCACCATTTCTATTACCGTCATCA	bbbbbbbbbabbbbbabb_bbbb_bbbab``bbbabbbbabbabaaaaaa]^aaaaa`aaa]aaZLZUUR`Z``^
    ILLUMINA-C3C24B_0047:3:120:18879:15229#0	77	*	0	0	**0	0	AGAGGCCTCATGCATGGNTAGAAGATNCNNTGNGAGGAATCCAANNGAAAGAACATGACTAGCCTGCTGTTATAC	bbbbbbbbbbbbbbb^[E[[ONNNNNEODDNOENNZZX[YOOOODE]W]X``a__`bba[_b^__`Ua_[Z_\\Z
    ILLUMINA-C3C24B_0047:3:120:18879:15229#0	141	*	0	0	**0	0	GAGAGCCTTCTCTAAGCTTCTTGGGTTGAGATTAGCTATTGAGTTGGAGATTCAAACCCTTTTGGAGGGATTGTA	bbbb^bbbbbbbbbbbZbbbbbbbbabbb`_b``bbbbbbbaa_aaabb_[a]ba_\bTaaa_a^YXX[[VTYTU
    ILLUMINA-C3C24B_0047:3:120:18879:7980#0	77	*	0	0	*	*00	GTGGATTTGGTAGCTTANTTTTAAGANANNTTNAACAAATGAAANNGTTGTTTAGTTGCCCAACACACAATTTTT	_Y[_]_Z__BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:7980#0	141	*	0	0	*	*00	GTGGTTTAGCAAATGCTTCAGATGATGCTCGAAGATCGAGCCAGAGGCAGGCTATCTTTGTAGAAGACAACGCTG	XPRZJ]YQ[[`__\`````___```^]aaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:9103#0	77	*	0	0	*	*00	GTTCCACTTTTGGAAGANCCTGCGTTNTNNCANCAGATCTTGATNNTTCATATATAAATGTAACTAATGTATCTC	bbbbbbbbbbbbbbbbbEbb^^^^^ODNDDNOEOO`^`^`NNOOEDOOOO`^^``bbbb``b\abbab`_bb`\_
    ILLUMINA-C3C24B_0047:3:120:18879:9103#0	141	*	0	0	*	*00	TATTTGTGAAAATGTATGTATAGCCAAAAAAGGACCACACCTAAAATCAGGTCAAGTTCTAATTGTTCAAGTTGA	bbbcbbabbbbbbbbbbbbbbbbbbbbbbXHWFVXYYYY[^bb\b_\`bb__^b_\\``]bab^_``aaa_^Y__
    ILLUMINA-C3C24B_0047:3:120:18879:8267#0	77	*	0	0	*	*00	AATGATAGAATGAAGAANTGCTCCCCNANNGTNTTCCGGACCTCNNTGTTGGGGGAGAAGGTCGCCGTGTTCTGT	bbbbbbbbbbbbbbbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    ILLUMINA-C3C24B_0047:3:120:18879:8267#0	141	*	0	0	*	*00	ATTCGATTTCGCCTAAATTATAATTTATGATAATAAATATATCAATTTGATGATTTAAGTGCAACGCCTTTGGGG	bbbb^b`bbbbbbbbb_bbbbbbbbVVWUVLVWVW]VYY]bbbabbbb]baa\`a]`^````[\\`[Z``b_Y^B
    ................................
    I thought I was supposed to have in each single line also the position on chromosome and the cigar field with the informaiton about snp and indels. Am I doing anything wrong?

    thanks four your help

  • #2
    For those reads you are showing BWA could not find alignments. That's why you don't see the chrm or any other mapping information.

    BWA will not call SNPs for you, it only find the best alignments for your short reads. You need a different tool to perform the SNP calling. The two most used tools are samtools (same author than BWA) and the GATK framework from the BI.
    -drd

    Comment

    Latest Articles

    Collapse

    • seqadmin
      The Impact of AI in Genomic Medicine
      by seqadmin



      Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
      Yesterday, 02:07 PM
    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 02-23-2024, 04:11 PM
    0 responses
    54 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-21-2024, 08:52 AM
    0 responses
    62 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-20-2024, 08:57 AM
    0 responses
    52 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-14-2024, 09:19 AM
    0 responses
    65 views
    0 likes
    Last Post seqadmin  
    Working...
    X