Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • doc2r
    Junior Member
    • Aug 2010
    • 9

    #1

    CollectGcBiasMetrics.jar

    Hi there,

    When I run PICARDs CollectGcBiasMetrics.jar I get the following error message



    Exception in thread "main" net.sf.samtools.SAMException: Exception counting mismatches for read XXXXXX_0164:6:6:3247:26441#0 1/2 100b aligned read.
    at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:251)
    at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:204)
    at net.sf.picard.analysis.CollectGcBiasMetrics.doWork(CollectGcBiasMetrics.java:15
    2)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:156)
    at net.sf.picard.analysis.CollectGcBiasMetrics.main(CollectGcBiasMetrics.java:94)
    Caused by: java.lang.ArrayIndexOutOfBoundsException: 135374737
    at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:237)
    ... 4 more


    I know the read XXXXXX_0164:6:6:3247:26441#0 1/2 maps to the telomeres and one maps off the end (this error I was able to "SILENT")but I really can't see what the problem. Any advice... Sequences are below





    XXXXXX_0164:6:6:3247:26441#0 163 chr10 135374442 23 21M1I26M52S = 135374638 297

    TTAGGGGTTAGGGTTGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGAGGGGTGGGGGGAGGGGTGTGGGGTGGGTGTGGGTGGGGGTGGG

    HHHHHFHAEAEEE?EGEE5B@DGDDCD?GGE7B5E<=4@<<@1<6C#####################################################
    XC:i:48 XT:A:U NM:i:1 SM:i:23 AM:i:23 X0:i:1 X1:i:1 XM:i:0 XO:i:1 XG:i:1 MD:Z:47


    XXXXXX_0164:6:6:3247:26441#0 83 chr10 135374638 23 1S47M1D4M1D48M = 135374442 -297
    TAGGGTTGGGGTGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTAGGGTAGGGTTAGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGT

    ##@?@@*@?DC/ACEDE>DBCB7ABEEF@E6FFDBG8GGFFFFFFEF@GEFGGGGGGFFFF@GFEFEFGGGGGFGGGGGGGGGGGGGEGGGFGGGGB

    XC:i:99 XT:A:M NM:i:13 SM:i:23 AM:i:23 XM:i:11 XO:i:2 XG:i:2 MD:Z:5G0A16G23^G4^T12G0A5A5A4G0A5A5A4
  • rpauly
    Member
    • Apr 2011
    • 32

    #2
    Did you find a solution to this? I am having the same problem...
    Exception in thread "main" net.sf.samtools.SAMException: Exception counting mismatches for read HWI-ST1392:125:C1HB2ACXX:5:2209:1874:47375 1/2 100b aligned read

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 07:41 AM
    0 responses
    12 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    39 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Working...