Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Different starting position in Genbank blast result?

    I am new to this field and this probably a very ignorant question.
    However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast returned me this following result. As seen in the result, matched sequences are in same chromosome yet seemed to have different indices. Thus thinking those are repeated regions, I was trying to locate those. However, I could find only one not even two. My assumption is that those numbers are not really indices. Can anyone help me to understand this problem? Thank you.


    >ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_5
    Length=4833398


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 108 bits (58), Expect = 7e-22
    Identities = 58/58 (100%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 2970579 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2970636


    >ref|NT_167245.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_3
    Length=4610396


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 108 bits (58), Expect = 7e-22
    Identities = 58/58 (100%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 2876461 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2876518


    >ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_2
    Length=4795371


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 102 bits (55), Expect = 3e-20
    Identities = 57/58 (99%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 3100500 TGTCTTTGGACACGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 3100557

  • #2
    Originally posted by khunny7 View Post
    I am new to this field and this probably a very ignorant question.
    However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast returned me this following result. As seen in the result, matched sequences are in same chromosome yet seemed to have different indices. Thus thinking those are repeated regions, I was trying to locate those. However, I could find only one not even two. My assumption is that those numbers are not really indices. Can anyone help me to understand this problem? Thank you.


    >ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_5
    Length=4833398


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 108 bits (58), Expect = 7e-22
    Identities = 58/58 (100%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 2970579 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2970636


    >ref|NT_167245.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_3
    Length=4610396


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 108 bits (58), Expect = 7e-22
    Identities = 58/58 (100%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 2876461 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2876518


    >ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
    assembly alternate locus group ALT_REF_LOCI_2
    Length=4795371


    Features in this part of subject sequence:
    large proline-rich protein BAT2

    Score = 102 bits (55), Expect = 3e-20
    Identities = 57/58 (99%), Gaps = 0/58 (0%)
    Strand=Plus/Plus

    Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 3100500 TGTCTTTGGACACGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 3100557

    The numbers you carefully colored in red are chromosome positions.

    They are starting positions for the alignments.

    -seb
    Last edited by seb567; 02-02-2011, 01:31 PM. Reason: typographical error

    Comment


    • #3
      Originally posted by seb567 View Post
      The numbers you carefully colored in red are chromosome positions.

      They are starting positions for the alignments.

      -seb
      Thanks for you reply, I can see that there are many matches but that sequence is not repetitive over chromosome 6.
      I did the local blast against hg19, and I could find only a single match.

      Comment


      • #4
        Each hit is for an alternate version of the human genome.

        ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
        assembly alternate locus group ALT_REF_LOCI_5 Length=4833398

        ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
        assembly alternate locus group ALT_REF_LOCI_2 Length=4795371

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM
        • seqadmin
          Strategies for Sequencing Challenging Samples
          by seqadmin


          Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
          03-22-2024, 06:39 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        21 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-04-2024, 09:00 AM
        0 responses
        46 views
        0 likes
        Last Post seqadmin  
        Working...
        X