Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • unionicola
    replied
    Thank you for your help.

    Previously, I was getting the following output results summary:

    Code:
    Input:                  	29978820 reads 		2188453860 bases.
    KTrimmed:               	135110 reads (0.45%) 	3873797 bases (0.18%)
    Total Removed:          29968470 reads (99.97%) 	2188332397 bases (99.99%)
    Result:                 	10350 reads (0.03%) 	121463 bases (0.01%)
    I'm not sure what I was doing differently, but when I repeated the search this morning using the following command (I need to search and remove multiple 8-mers):

    Code:
    bbduk.sh in=input.fastq literal=AGTCATGC,ACGTACTG,TGACTGCA,TCGACGAT,CTAGCATG,GACTGTAC ktrim=l k=8 rcomp=f outm=removed.fastq out=trimmed.fastq
    It gave me the following results:

    Code:
    Input:                  	29978820 reads 		2188453860 bases.
    KTrimmed:               	135110 reads (0.45%) 	3873797 bases (0.18%)
    Total Removed:          9706 reads (0.03%) 	3873797 bases (0.18%)
    Result:                 	29969114 reads (99.97%) 	2184580063 bases (99.82%)
    When I look in removed.fastq, I only see the left most of the reads (from the indicated 8-mer). So it looks like it is working now, but I'm confused as to why/how.

    Nonetheless, at least I'm getting the results I want! Thanks for your help again!

    Leave a comment:


  • SNPsaurus
    replied
    I just tried your code on a test set with a random kmer in the 3rd read in bold

    Code:
    @NGSNJ-086:222:GW191226409th:1:1103:5556:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    ACTCAAAAACTTTGCTTTCTCAACATTCACCTAAGTCTACATTAAAATTCTTGCATCTTCTAACTCGTGTTCGCTAAGTAATGAAGCATCGTTTATTCAACACTTTTTTTTTACCTAATGGAACTAATTAATTATGTTTATCTTTCTTTG
    +
    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:F:FFFF:FFFFFF
    @NGSNJ-086:222:GW191226409th:1:1103:5900:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    GTCCAACACATCAAGGAGTGATTGATGTGAAATGGGTATTTAGGAACAAAAAGGATGAAAATGCTGAAATAATCGGAAATAAGGCAAGATTAGTTGCCAAAGGTTACTGTCAACAAGAATGGATAGACTATGATGAGACCTATGCTCCAG
    +
    FFFFFFFFFFFFF,FF:FFFF::FFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF
    @NGSNJ-086:222:GW191226409th:1:1103:5990:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    GTGTACGAATTTCACATTATCGAAAATCTCATTTGTTTGGAAACATTTCCTCTTGGT[B]GTCTTCGA[/B]ACATGTAAGAAATGTAAAATTCATACCAAAATCGGGTAAGAATTTCATAATTATATAAGTATATGGTTATTGGTATGAATATAAT
    +
    FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF
    bbduk.sh in=test.fq literal=GTCTTCGA ktrim=l k=8 rcomp=f out=test_out.fastq
    Input: 3 reads 450 bases.
    KTrimmed: 1 reads (33.33%) 65 bases (14.44%)
    Total Removed: 0 reads (0.00%) 65 bases (14.44%)
    Result: 3 reads (100.00%) 385 bases (85.56%)

    cat test_out.fastq
    Code:
    @NGSNJ-086:222:GW191226409th:1:1103:5556:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    ACTCAAAAACTTTGCTTTCTCAACATTCACCTAAGTCTACATTAAAATTCTTGCATCTTCTAACTCGTGTTCGCTAAGTAATGAAGCATCGTTTATTCAACACTTTTTTTTTACCTAATGGAACTAATTAATTATGTTTATCTTTCTTTG
    +
    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:F:FFFF:FFFFFF
    @NGSNJ-086:222:GW191226409th:1:1103:5900:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    GTCCAACACATCAAGGAGTGATTGATGTGAAATGGGTATTTAGGAACAAAAAGGATGAAAATGCTGAAATAATCGGAAATAAGGCAAGATTAGTTGCCAAAGGTTACTGTCAACAAGAATGGATAGACTATGATGAGACCTATGCTCCAG
    +
    FFFFFFFFFFFFF,FF:FFFF::FFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF
    @NGSNJ-086:222:GW191226409th:1:1103:5990:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
    ACATGTAAGAAATGTAAAATTCATACCAAAATCGGGTAAGAATTTCATAATTATATAAGTATATGGTTATTGGTATGAATATAAT
    +
    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF
    So it worked on my set. Can you set outm= and look at what is being removed?

    You could also try kmask=# to see if it is finding the kmer desired.

    Leave a comment:


  • unionicola
    started a topic bbduk and removing adapters of varying length

    bbduk and removing adapters of varying length

    I am analyzing some published Tn-seq data. There appears to be residual transposon sequence in the reads, preventing alignment. Unfortunately, this sequence is of variable length. Here are some example reads, the transposon sequence is undrelined:

    ATTCCGCTCTTCCGATCTAGTCATGCGCGGCCGCATAACATAACCGGTTGGATGATAAGTCCCCGGTCTATAT
    ATTCTTCCCTACACGACGCTCTTCCGATCTAGTCATGCGCCGGAGCATTAGGTAACAGGTTGGATGATAAGTC
    ATGCAGTCATGCAAATGATAACAGGTTGGATGATAAGTCCCCGGTCTATATTGAGAGTAACTACATTTACCGT
    ATTCATCATTGCGGCAGTCATGCCTATTGTTCCTGGTGTAACAGGTTGGATGATAAGTCCCCGGTCTATATTG


    I want to search for the last 8 bases of the transposon sequence (AGTCATGC) and remove any sequence to the left of it, but retaining all the remaining sequence in the read and any read wherein there is no transposon sequence. I've been trying bbduk using the following command:

    Code:
    bbduk.sh in=$in.fastq literal=AGTCATGC ktrim=l k=8 rcomp=f out=$out.fastq
    But this seems to result in nearly every read being removed (the values drop from over 4 million to about 20,000).

    Can any one help me with this issue? Thanks!

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 02:06 PM
0 responses
7 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
47 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Working...
X