Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • rlegendre
    Junior Member
    • Sep 2010
    • 7

    Decoding colorspace alignments by Bowtie

    Hi all,

    I am using Bowtie to map SOLID read in horse genome reference, in order to discover new miRNA. I employ the commande line :
    Code:
    ./bowtie --sam -f -a -m 6 -C -v 2 --best --strata <path_fasta> <path_sam>
    and I obtain this output :


    2_18_1468_F3 0 3 19908716 255 22M ACCACAGGGTAGAACCACGGTC IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:20A1 NM:i:1 CM:i:2
    2_18_1468_F3 0 18 17330428 255 22M CAACACTTTGCTCCAACAAACT Iqqqqqqqqqqqqqqqq!!qqI XA:i:2 MD:Z:21A0 NM:i:1 CM:i:2
    2_18_1468_F3 0 6 76907837 255 22M TGCACACCCATCTTGGTGCCAG I!!qq!!qqqqqqqqqqqqqqI XA:i:2 MD:Z:22 NM:i:0 CM:i:2
    2_18_1468_F3 0 22 26347698 255 22M GTTGTTCCCATCTTGGTGCCTC Iqqq!!qqqqqqqqqqqqq!!I XA:i:2 MD:Z:22 NM:i:0 CM:i:2
    2_18_1468_F3 16 21 55207881 255 22M GACCGTGGGGAGCGGGACACCA Iqqqqqq!!qqq!!qqqqqqqI XA:i:2 MD:Z:22 NM:i:0 CM:i:2

    In my bowtie manual interpretation, the NM field represent mismatch between decoding read and reference, i.e. mismatchs in nucleotidic alignment, and CM field colorspace mismatch. So, in my SAM file, for a same read with 2 colorspace mismatch, number of nucleotide mismatch change ?? I don't understand why ! Anybody who work with SOLID read can help me ?

    Moreover, I test --snpfrac option of bowtie, and once again, results are amazing. For the same read I have :

    2_18_1468_F3 0 6 76907837 255 22M TGGTGTCCCATCTTGGTGCCAG IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:2C0A0C0A16 NM:i:4 CM:i:2
    2_18_1468_F3 0 22 26347698 255 22M TGGTGTCCCATCTTGGTGCCAG IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:0G0T0T0G0T15T0C0 NM:i:7 CM:i:2
    2_18_1468_F3 0 3 19908716 255 22M ACCACAGGGTAGAACCACGGTC IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:20A1 NM:i:1 CM:i:2
    2_18_1468_F3 0 18 17330428 255 22M CAACACTTTGCTCCAACATTGA IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:18A0A0C1 NM:i:3 CM:i:2
    2_18_1468_F3 16 21 55207881 255 22M CTGGCACCAAGATGGGACACCA IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:0G0A0C0C0G0T0G0G0G0G0A0G0C9 NM:i:13 CM:i:2

    Here, the two first alignments are against two chromosomic locations which are identical sequence (perfect match between this two sequence), but if we look the NM field, they are differents ! How a same read which map against two identical sequences can be have a mismatch number different ? So, I wonder if bowtie can manage colorspace (and SNP) and how ?

    Thanks

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
20 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
30 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
17 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Working...