Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • What is this format? How to run bowtie on it.

    I am a newbie to NGS. Please help.

    I have the following file (I was told that it is a export file of illumina)

    HWUSI-EAS1744 1 8 1 1165 18707 0 1 CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB NM N
    HWUSI-EAS1744 1 8 1 1166 9747 0 1 GGCAAGCCGGATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGG bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB 0:0:1 Y

    Q1: How do I convert this to fastaq format?
    Q2: Is bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB the quality score?
    Q3: How to run bowtie on this file.

    Thanks.

  • #2
    Format

    This is an export file.
    HWUSI-EAS1744181116518700 1 - Unique Read Identifier
    CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG - Sequence

    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB - Quality Score in Illumina Platform

    N - The Y or N in the last column is from the Illumina CHASITY filter. Y means yes it pass N means no . I don't think you should use the N sequences.

    Comment


    • #3
      Might I also suggest reading this thread
      New here? Stop in and introduce yourself. Where you are, what you work on, etc.

      Comment


      • #4
        Thanks for the reply.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Today, 06:54 AM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-14-2024, 07:24 AM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-13-2024, 08:58 AM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-12-2024, 02:20 PM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Working...
        X