Hi,
I listed below some differents and weird mapping results obtain with Bowtie 0.12.7 on solid data.
1: SNP appearance
[1]-----Read: T3101112001322010113012
[2]--Decoded: 3101112001322010113012
[3]Reference: 3101112001322010113012
It's EXACTLY the same ! But the final decoded nucleotide sequence makes appear a A which is neither in the read sequence nor in the reference sequence.
What happens here ?...
2: Color appearance
[1]------Read: 1310202132120311223010T (reverse)
[2]--Decoded: 131120213212031122301
[3]Reference: 132220213212031122301
How can I observe three different color ? The decoded nuc shouldn't be in the read or in the reference ?
3: ????
[1]------Read: 1310202132120311223010T (reverse)
[2]--Decoded: 131020213212031122301
[3]Reference: 131020213212031102101
Is someone obtain the same kind of results ? Is it normal ? Maybe I missunderstoud the decoding colorspace step.
[1] Original read color sequence
[2] Decoded color sequence (from decoded nucleotide sequence)
[3] Reference sequence color:
I listed below some differents and weird mapping results obtain with Bowtie 0.12.7 on solid data.
1: SNP appearance
Code:
2_18_1468_F3 0 3 19908716 255 22M * 0 0 ACCACAGGGTAGAACCACGGTC IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:20A1 NM:i:1 CM:i:2
[2]--Decoded: 3101112001322010113012
[3]Reference: 3101112001322010113012
It's EXACTLY the same ! But the final decoded nucleotide sequence makes appear a A which is neither in the read sequence nor in the reference sequence.
What happens here ?...
2: Color appearance
Code:
2_28_457_F3 16 1 32349243 255 22M * 0 0 CATGTCCTGCTGAATGTCTAAC Iqq!!qqqqqqqqqqqqqqqqI XA:i:2 MD:Z:3C18 NM:i:1 CM:i:2
[2]--Decoded: 131120213212031122301
[3]Reference: 132220213212031122301
How can I observe three different color ? The decoded nuc shouldn't be in the read or in the reference ?
3: ????
Code:
2_28_457_F3 16 3 30644442 255 22M * 0 0 CATGGAAGTAGTCCGTGAGCCA IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:17G0A3 NM:i:2 CM:i:2
[2]--Decoded: 131020213212031122301
[3]Reference: 131020213212031102101
Is someone obtain the same kind of results ? Is it normal ? Maybe I missunderstoud the decoding colorspace step.
[1] Original read color sequence
[2] Decoded color sequence (from decoded nucleotide sequence)
[3] Reference sequence color: