Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bowtie - SOLiD : Weird decoding examples

    Hi,
    I listed below some differents and weird mapping results obtain with Bowtie 0.12.7 on solid data.
    1: SNP appearance
    Code:
    2_18_1468_F3    0    3    19908716    255    22M    *    0    0    ACCACAGGGTAGAACCACGGTC    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:20A1    NM:i:1    CM:i:2
    [1]-----Read: T3101112001322010113012
    [2]--Decoded: 3101112001322010113012
    [3]Reference: 3101112001322010113012
    It's EXACTLY the same ! But the final decoded nucleotide sequence makes appear a A which is neither in the read sequence nor in the reference sequence.
    What happens here ?...

    2: Color appearance
    Code:
    2_28_457_F3    16    1    32349243    255    22M    *    0    0    CATGTCCTGCTGAATGTCTAAC    Iqq!!qqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:3C18    NM:i:1    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131120213212031122301
    [3]Reference: 132220213212031122301
    How can I observe three different color ? The decoded nuc shouldn't be in the read or in the reference ?

    3: ????
    Code:
    2_28_457_F3    16    3    30644442    255    22M    *    0    0    CATGGAAGTAGTCCGTGAGCCA    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:17G0A3    NM:i:2    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131020213212031122301
    [3]Reference: 131020213212031102101

    Is someone obtain the same kind of results ? Is it normal ? Maybe I missunderstoud the decoding colorspace step.

    [1] Original read color sequence
    [2] Decoded color sequence (from decoded nucleotide sequence)
    [3] Reference sequence color:

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
43 views
0 likes
Last Post seqadmin  
Working...
X