Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • smarthey
    Junior Member
    • May 2010
    • 3

    #1

    Bowtie - SOLiD : Weird decoding examples

    Hi,
    I listed below some differents and weird mapping results obtain with Bowtie 0.12.7 on solid data.
    1: SNP appearance
    Code:
    2_18_1468_F3    0    3    19908716    255    22M    *    0    0    ACCACAGGGTAGAACCACGGTC    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:20A1    NM:i:1    CM:i:2
    [1]-----Read: T3101112001322010113012
    [2]--Decoded: 3101112001322010113012
    [3]Reference: 3101112001322010113012
    It's EXACTLY the same ! But the final decoded nucleotide sequence makes appear a A which is neither in the read sequence nor in the reference sequence.
    What happens here ?...

    2: Color appearance
    Code:
    2_28_457_F3    16    1    32349243    255    22M    *    0    0    CATGTCCTGCTGAATGTCTAAC    Iqq!!qqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:3C18    NM:i:1    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131120213212031122301
    [3]Reference: 132220213212031122301
    How can I observe three different color ? The decoded nuc shouldn't be in the read or in the reference ?

    3: ????
    Code:
    2_28_457_F3    16    3    30644442    255    22M    *    0    0    CATGGAAGTAGTCCGTGAGCCA    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:17G0A3    NM:i:2    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131020213212031122301
    [3]Reference: 131020213212031102101

    Is someone obtain the same kind of results ? Is it normal ? Maybe I missunderstoud the decoding colorspace step.

    [1] Original read color sequence
    [2] Decoded color sequence (from decoded nucleotide sequence)
    [3] Reference sequence color:

Latest Articles

Collapse

  • SEQadmin2
    New Genomics Technologies Take Aim at Long-Standing Limits
    by SEQadmin2


    Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

    We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
    ...
    09-28-2026, 10:25 AM
  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    09-01-2026, 05:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 09:51 AM
0 responses
10 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-25-2026, 09:06 AM
0 responses
32 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-23-2026, 11:05 AM
0 responses
27 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-18-2026, 11:37 AM
1 response
48 views
0 reactions
Last Post pekgio
by pekgio
 
Working...