Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Eland exit code: 2304

    Dear all,

    I am currently trying to align some reads using Eland (GAPipeline 1.5 via the ...standalone.pl) and I keep getting the following error code, no matter what reference I use. My suspicion lies on the formatting of the reads, but I can't narrow it down. The reads look like this:

    @GRCh37:21:1:48129895:206#NNNNNN/1
    CTGATAATCAGCAAAATATAAAGTAACAAGAATAC
    +GRCh37:21:1:48129895:206#NNNNNN/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
    @GRCh37:21:1:48129895:207#NNNNNN/1
    CTCAAAATGTTTTAGCATCTTTCGGTAAAATTCTT
    +GRCh37:21:1:48129895:207#NNNNNN/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
    @GRCh37:21:1:48129895:208#NNNNNN/1
    AGGAATCCATGCCTATAGGGTAAGATGTGGAAATT
    +GRCh37:21:1:48129895:208#NNNNNN/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
    @GRCh37:21:1:48129895:209#NNNNNN/1
    GCAAATGCATAGTCTATGGCAGTTACCAGTGTAGC
    +GRCh37:21:1:48129895:209#NNNNNN/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh


    and the output of Eland looks like this:


    eland -if ~/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq -it fastq -eg Homo_sapiens.GRCh37.61.dna.chromosome.21.fa
    $VAR1 = {
    'read-length' => [
    -1
    ],
    'pair-params' => '--circular',
    'pipeline-dir' => '/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./..',
    'input-file' => [
    '/home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq'
    ],
    'seed-length' => [
    -1
    ],
    'output-prefix' => './reanalysis',
    'base-quality' => 30,
    'eland-genome' => 'Homo_sapiens.GRCh37.61.dna.chromosome.21.fa',
    'input-type' => 'fastq'
    };
    /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: single input-file specified, will do single read analysis
    /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: deduced read length of 35 for data in /home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq
    /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: Setting seed length for ./reanalysis_eland_extended.txt to 32
    /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: About to run /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./../bin/buildSeq.pl --fasta ./reanalysis_qseq.txt > ./reanalysis_eland_query.txt

    Argument "" isn't numeric in sprintf at /home/rboettcher/aligner/GAPipeline-1.5.0/lib/perl/Gerald/Common.pm line 381, <GEN0> line 1.


    =======================================================================
    exit code: 2304
    buildSeq using ./reanalysis_qseq.txt did not finish properly!

    Exiting...
    =======================================================================


    Does anyone know how I could proceed / fix this problem?

    Regards

  • #2
    I've also tried some of the headers that are public (e.g. wikipedia), still no improvement, though I was able to narrow down the error:

    the sequence identifier

    e.g. @HWUSI-EAS100R:6:73:941:1973#0/1 (source: wikipedia)

    is split into the following parts:

    machineName, runNumber, lane, tile, x, y, readPairMode, indexBases

    Since the program states that the runNumber is missing, I guess that the identifier is not complete, so I will try to find out what the program is expecting (though I am irritated that it has problems with the above identifier that is supposed to work fine). I will update the thread on this matter, so if anybody has the same problem or any experiences, feel free to join the fun.

    Regards

    Comment


    • #3
      Perhaps try another aligner like BWA or novoalign. These programs will accept the FASTQ format in your example.

      Comment


      • #4
        Already thought about this, but I somehow managed to find a solution by editing the source code to create a runnumber out of the machinename. So now I just have to add "_somenumber" to the machinename which will then be used as the runnumber, though I have no idea what the number is for in the first place...

        As far as I can say the alignment will work fine afterwards (at least for the data that I have used). Still a stupid problem that has cost me a lot of time. If anybody stumbles over the same problem and needs details how to fix it feel free to contact me.

        Regards

        Comment

        Latest Articles

        Collapse

        • seqadmin
          The Impact of AI in Genomic Medicine
          by seqadmin



          Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
          02-26-2024, 02:07 PM
        • seqadmin
          Multiomics Techniques Advancing Disease Research
          by seqadmin


          New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

          A major leap in the field has
          ...
          02-08-2024, 06:33 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 02-28-2024, 06:12 AM
        0 responses
        26 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-23-2024, 04:11 PM
        0 responses
        74 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-21-2024, 08:52 AM
        0 responses
        81 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-20-2024, 08:57 AM
        0 responses
        69 views
        0 likes
        Last Post seqadmin  
        Working...
        X