Eland exit code: 2304

[rboettcher]

Dear all,

I am currently trying to align some reads using Eland (GAPipeline 1.5 via the ...standalone.pl) and I keep getting the following error code, no matter what reference I use. My suspicion lies on the formatting of the reads, but I can't narrow it down. The reads look like this:

@GRCh37:21:1:48129895:206#NNNNNN/1
CTGATAATCAGCAAAATATAAAGTAACAAGAATAC
+GRCh37:21:1:48129895:206#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:207#NNNNNN/1
CTCAAAATGTTTTAGCATCTTTCGGTAAAATTCTT
+GRCh37:21:1:48129895:207#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:208#NNNNNN/1
AGGAATCCATGCCTATAGGGTAAGATGTGGAAATT
+GRCh37:21:1:48129895:208#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:209#NNNNNN/1
GCAAATGCATAGTCTATGGCAGTTACCAGTGTAGC
+GRCh37:21:1:48129895:209#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh


and the output of Eland looks like this:


eland -if ~/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq -it fastq -eg Homo_sapiens.GRCh37.61.dna.chromosome.21.fa
$VAR1 = {
'read-length' => [
-1
],
'pair-params' => '--circular',
'pipeline-dir' => '/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./..',
'input-file' => [
'/home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq'
],
'seed-length' => [
-1
],
'output-prefix' => './reanalysis',
'base-quality' => 30,
'eland-genome' => 'Homo_sapiens.GRCh37.61.dna.chromosome.21.fa',
'input-type' => 'fastq'
};
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: single input-file specified, will do single read analysis
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: deduced read length of 35 for data in /home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: Setting seed length for ./reanalysis_eland_extended.txt to 32
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: About to run /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./../bin/buildSeq.pl --fasta ./reanalysis_qseq.txt > ./reanalysis_eland_query.txt

Argument "" isn't numeric in sprintf at /home/rboettcher/aligner/GAPipeline-1.5.0/lib/perl/Gerald/Common.pm line 381, <GEN0> line 1.


=======================================================================
exit code: 2304
buildSeq using ./reanalysis_qseq.txt did not finish properly!

Exiting...
=======================================================================


Does anyone know how I could proceed / fix this problem?

Regards

[rboettcher]

I've also tried some of the headers that are public (e.g. wikipedia), still no improvement, though I was able to narrow down the error:

the sequence identifier

e.g. @HWUSI-EAS100R:6:73:941:1973#0/1 (source: wikipedia)

is split into the following parts:

machineName, runNumber, lane, tile, x, y, readPairMode, indexBases

Since the program states that the runNumber is missing, I guess that the identifier is not complete, so I will try to find out what the program is expecting (though I am irritated that it has problems with the above identifier that is supposed to work fine). I will update the thread on this matter, so if anybody has the same problem or any experiences, feel free to join the fun.

Regards

[zee]

Perhaps try another aligner like BWA or novoalign. These programs will accept the FASTQ format in your example.

[rboettcher]

Already thought about this, but I somehow managed to find a solution by editing the source code to create a runnumber out of the machinename. So now I just have to add "_somenumber" to the machinename which will then be used as the runnumber, though I have no idea what the number is for in the first place...

As far as I can say the alignment will work fine afterwards (at least for the data that I have used). Still a stupid problem that has cost me a lot of time. If anybody stumbles over the same problem and needs details how to fix it feel free to contact me.

Regards