Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Gap penalty in BWA

    I'm using BWA MEM to align paired-end fastq files to two reference sequences (50bp and 80bp):

    >ref1
    TCGTAACGCAAGTTGGATACTCTCGA******************************GGATGTTGCCGTCCTCCTTGAAGT

    >ref2
    TCGTAACGCAAGTTGGATACTCTCGATTGCAAGTAGTCGATTGCATTGTCAATCTAGGATGTTGCCGTCCTCCTTGAAGT

    These two sequences are idential except the middle bit. I then used samtools to filter out properly paired reads from each sequence based on identifiers but surprisingly it showed overwhelming majority of reads have the number of matches that correspond to **ref2** and 0 properly paired reads for **ref1**

    I verified this result by repeating the process for each sequence individually and got the same output:

    ```
    $ samtools flagstat mysam.sam

    1055596 + 0 in total (QC-passed reads + QC-failed reads)
    0 + 0 secondary
    0 + 0 supplementary
    0 + 0 duplicates
    20960 + 0 mapped (1.99% : N/A)
    1055596 + 0 paired in sequencing
    527798 + 0 read1
    527798 + 0 read2
    0 + 0 properly paired (0.00% : N/A)
    20934 + 0 with itself and mate mapped
    26 + 0 singletons (0.00% : N/A)
    0 + 0 with mate mapped to a different chr
    0 + 0 with mate mapped to a different chr (mapQ>=5)
    ```
    I then tried setting high values for gap opens and extension penalties in order to limit the chance that hits from alignments of **ref1** reads result in origin of **ref2**. By doing this, I now can see some properly paired reads from **ref1**. However, one thing I don't understand is that the total number of reads as well as properly paired reads increased while these should be reduced because of gap penalties.

    Can someone explain to me:

    1. Is it normal to see 0 properly paired reads in this case?
    2. Why does disallowing reads with open and extension gaps increase the total of reads?

    Many thanks

Latest Articles

Collapse

  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    Yesterday, 07:01 AM
  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
58 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
53 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
55 views
0 likes
Last Post seqadmin  
Working...
X