Announcement

Collapse

Welcome to the New Seqanswers!

Welcome to the new Seqanswers! We'd love your feedback, please post any you have to this topic: New Seqanswers Feedback.
See more
See less

Split read based on conserved sequence repeat

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Split read based on conserved sequence repeat

    I have reads that contain repeats of 10 nt (conserved sequence is known). I want to split the reads into subunits, using the 10 nt as "marker" to know where to split.

    As example (conserved sequence is cccgggttta):
    >
    acagtacccgggtttaatcgatcgatcgtacccgggtttagtacgtacgatcgtcccgggtttatgctgtcgtc

    To get:
    >
    acagtacccgggttta
    >
    atcgatcgatcgtacccgggttta

    >
    gtacgtacgatcgtcccgggttta

    >
    tgctgtcgtc

    Help is appreciated, thank you
    Last edited by Pol2021; 10-21-2021, 09:33 PM.
Working...
X