Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
Leave a comment:
-
Yes, cores are available as I did run it in a computer cluster. That is not a problem I think.
Latest update: When I changedrescuemismatches 1 to 222G Oct 25 13:42 2008-27-201.aligned.sam
120G Oct 25 13:42 2008-27-201.unaligned.sam
Leave a comment:
-
Do you have 20 cores available on the machine for BBMap to use. What happens if you assign fewer cores? Starting with 8 would be a good number.
Leave a comment:
-
mapping with bbmap anderror
I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.
I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)
Code:job starting at 09:42:42 java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto] Version 38.61 Scaffold statistics will be written to 2008_27.scafstats Set threads to 20 Ambiguously mapped reads will be considered unmapped. Set genome to 1 Loaded Reference: 2.025 seconds. Loading index for chunk 1-1, build 1 Generated Index: 3.261 seconds. Analyzed Index: 2.517 seconds. Started output stream: 0.371 seconds. Started output stream: 0.023 seconds. Creating scaffold statistics table: 0.065 seconds. Cleared Memory: 0.516 seconds. Processing reads in paired-ended mode. Started read stream. Started 20 mapping threads. Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG 0 -1 + -1 -1 00000000000000000000000 1 0 0 ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF . . . . at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1097) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG 601 -1 + -1 -1 00000000001000000000000 1 0 0 CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF . . . . 1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1090) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG 1002 -1 + -1 -1 00000000000000000000000 1 0 0 GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF . . . . 1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823 1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1097) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG 1404 -1 + -1 -1 00000000001000000000000 1 0 0 NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF . . . . 1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1090) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG 3802 -1 + -1 -1 00000000001000000000000 1 0 0 GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF . . . . 1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0 1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) ------------------- --------------------- ----------------------------- , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 ************************************************************************** Warning! 20 mapping threads did not terminate normally. Check the error log; the output may be corrupt or incomplete. Please submit the full stderr output as a bug report, not just this message. ************************************************************************** ------------------ Results ------------------ Genome: 1 Key Length: 13 Max Indel: 16000 Minimum Score Ratio: 0.56 Mapping Mode: normal Reads Used: 212 (28878 bases) Mapping: 0.669 seconds. Reads/sec: 316.77 kBases/sec: 43.15 Pairing data: pct pairs num pairs pct bases num bases mated pairs: 2.8302% 3 1.9600% 566 bad pairs: 0.0000% 0 0.0000% 0 insert size avg: 97.67 Read 1 data: pct reads num reads pct bases num bases mapped: 2.8302% 3 1.9552% 283 unambiguous: 2.8302% 3 1.9552% 283 ambiguous: 0.0000% 0 0.0000% 0 low-Q discards: 0.9434% 1 1.0432% 151 perfect best site: 0.0000% 0 0.0000% 0 semiperfect site: 0.0000% 0 0.0000% 0 rescued: 0.0000% 0 Match Rate: NA NA 86.9258% 246 Error Rate: 100.0000% 3 9.1873% 26 Sub Rate: 100.0000% 3 9.1873% 26 Del Rate: 0.0000% 0 0.0000% 0 Ins Rate: 0.0000% 0 0.0000% 0 N Rate: 33.3333% 1 3.8869% 11 Read 2 data: pct reads num reads pct bases num bases mapped: 2.8302% 3 1.9647% 283 unambiguous: 2.8302% 3 1.9647% 283 ambiguous: 0.0000% 0 0.0000% 0 low-Q discards: 1.8868% 2 1.8189% 262 perfect best site: 0.0000% 0 0.0000% 0 semiperfect site: 0.0000% 0 0.0000% 0 rescued: 0.0000% 0 Match Rate: NA NA 89.0459% 252 Error Rate: 100.0000% 3 9.5406% 27 Sub Rate: 100.0000% 3 9.5406% 27 Del Rate: 0.0000% 0 0.0000% 0 Ins Rate: 0.0000% 0 0.0000% 0 N Rate: 33.3333% 1 1.4134% 4 Exception in thread "main" java.lang.AssertionError: The number of reads out does not add up to the number of reads in. This may indicate that a mapping thread crashed. If you submit a bug report, include the entire console output, not just this error message. 3+0+0+82+1+0 = 86 != 106 at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961) at align2.AbstractMapper.printOutput(AbstractMapper.java:1059) at align2.BBMap.testSpeed(BBMap.java:522) at align2.BBMap.main(BBMap.java:35) job finishing at 09:42:59
Last edited by abubd; 10-25-2021, 12:54 AM.Tags: None
Latest Articles
Collapse
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 12:17 PM
|
0 responses
13 views
0 likes
|
Last Post
by seqadmin
Yesterday, 12:17 PM
|
||
Started by seqadmin, 04-29-2024, 10:49 AM
|
0 responses
19 views
0 likes
|
Last Post
by seqadmin
04-29-2024, 10:49 AM
|
||
Started by seqadmin, 04-25-2024, 11:49 AM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
04-25-2024, 11:49 AM
|
||
Started by seqadmin, 04-24-2024, 08:47 AM
|
0 responses
22 views
0 likes
|
Last Post
by seqadmin
04-24-2024, 08:47 AM
|
Leave a comment: