I algined a single end sample against HG18 reference using the latest BWA. Then I tried to convert the sam file to bam file using samtools,
I got the following error,
Parse error at line 119: sequence and quality are inconsistent
and line 119 looks like
HWI-EAS266_0011:1:1:6:1607#0 16 12 2662146 37 1S35M * 0 0 GGGAACAAATGTGGGGAGGCAGAGGCAGGTCCCTGA $ $$""####$""$#$"###
I searched around, seen people talking about this, but no real solution.
Anyone have any idea?
I got the following error,
Parse error at line 119: sequence and quality are inconsistent
and line 119 looks like
HWI-EAS266_0011:1:1:6:1607#0 16 12 2662146 37 1S35M * 0 0 GGGAACAAATGTGGGGAGGCAGAGGCAGGTCCCTGA $ $$""####$""$#$"###
I searched around, seen people talking about this, but no real solution.
Anyone have any idea?
Comment