[kevluv93]

Haha! I finally got it to work! It was just some user error on my part.

Changes:
Don't use "C:" at the beginning of files.
It works fine with Windows 8
I erased the ".fq" at the end of my input files, I thought I was supposed to specify what file type my input data was, but don't. The name of the file's good enough.

Worked like a charm, it was just user error on my part. Thanks for the help!

[MikhailFokin]

could you please give a real example of using -baseout flag?
when using like this "... -phred33 PE S1R1.fatsq S1R2.fastq -baseout outS1.fasta ILLUMINACLIP..." it is still trying to find the list on names afterwards...

[MikhailFokin]

Hi guys, seems that Trimmomatic is very useful and performs better that others.

The only thing I can not find, if present at all. Where can I get the info if any adaptor clipping appeared? Yes I can analyse the result by fastqc or go deep to log (still no info for clipping), but is there any obvious place to find adaptor clipping results?

The second question is - what is the clipping/trimming strategy applied for internal (junction Nextera adaptors)?

[Brian Bushnell]

kevluv,

You are not doing anything wrong with Java; your command would fail in any environment. The classpath appears to be correct, you just have the wrong command line.

[kevluv93]

Could you guys give me an example script of setting up a classpath for "ILLUMINACLIP:" to get access to the adapter files in the trimmomatic binary download? I should probably mention that my experience with scripting languages begins and ends with "making stick figures in JavaScript", so forgive me if I'm asking for baby steps. I'm still using Windows 8 for this trimmomatic job (it's the OS that all the computers in our college use, so I don't really have a choice.)

@ Bjorn, you mentioned "having the clip file in the actual directory", and that trimmomatic looks for documents after ":". With this info, I deleted the "C:" that came after ILLUMINACLIP: but I got an error message telling me, "ArrayIndexOutOfBoundsException: 1".

@Brian Bushnell, you mentioned that trimmomatic will work on windows as long as I specify the classpaths to the files correctly.

So, could someone give me an example of what I need to write after "ILLUMINACLIP:" to let "ILLUMINACLIP:" get the adapter sequence fa. files that are saved on my desktop? I'm just right clicking these icons and copy/pasting their locations into the trimmomatic script. How else does one make a path to a file?

Thanks for the help! Any input is appreciated!

[tsangkl]

What was the trimmomatic command that you used, and what sequences did you use in the adapters fasta file?

java -jar trimmomatic-0.32.jar PE -threads 11 -trimlog trim_keepbothread.log Hiseq_1.fastq Hiseq_2.fastq Hiseq_1_keeppaired.fastq Hiseq_1_keepunpaired.fastq Hiseq_2_keeppaired.fastq Hiseq_2_keepunpaired.fastq ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

And my adapter fasta file contain the transposase sequence and primer sequence provided by illumina:

>Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

>Primerprefixi5_rc
GACGCTGCCGACGA
>Primerprefixi7_rc
CCGAGCCCACGAGAC


Thanks

[Brian Bushnell]

I figured it would come to that. I think my best option would be to use Linux and not have to direct trimmomatic using "C:". Don't file paths in Linux all begin with a "/home/..."? I'll try that and see if it works.

No, not really. The path depends on the system... Java works fine in Windows, and as long as the classpath is set correctly, it should work fine anywhere. You just need to set the "-cp" variable correctly.

[kevluv93]

I figured it would come to that. I think my best option would be to use Linux and not have to direct trimmomatic using "C:". Don't file paths in Linux all begin with a "/home/..."? I'll try that and see if it works.

[usad]

Hi

sorry for the inconvenience. At the moment it might be best to not have to use C: at all as trimmomatic looks for data after :
E.g. having the clip file in the actual directory - yukk.

Best Wishes
Björn

[kevluv93]

@mastal

Thank you for the quick reply! Unfortunately, it's still displaying the same error message. But at least I know the problem is around there, so that's good news.

So, could there be a way to possibly direct trimmomatic to the file without beginning with C:? Or could this possibly be another issue?

I've tried other symbols like brackets and parenthesis just in case 'C:' wasn't it. Same message.

[Brian Bushnell]

You probably have the parameters in the wrong order. Java is parsing "\Users\kevluv93\Desktop\Trimmomatic-0.32\Trimmomatic-0.32\TruSeq3-PE.fa" and expecting an integer, which it is not. I'm not a Trimmomatic expert and I don't know the correct command line, but Trimmomatic should work fine on Windows with the correct command.

If you continue to have problems, send me a pm.

[mastal]

@kevluv93

I have not used trimmomatic on Windows, but it looks as if it's expecting what comes after 'C:' to be the second parameter for the ILLUMINACLIP command.

Try putting quotes around the path to the fasta file and see if that helps.

ILLUMINACLIP:'C:\Users\kevluv93\Desktop\Trimmomatic-0.32\Trimmomatic-0.32\TruSeq3-PE.fa':2:30:10

[kevluv93]

Hi! I think I'm putting in the trimmomatic code incorrectly. I'm using the binary file download of trimmomatic, I'm running these programs off of windows 8 (that might be a problem), and I'm using fastq files that need paired end adapter sequence trimming.

Here is the script I'm using:

java -jar C:\Users\kevluv93\Desktop\Trimmomatic-0.32\Trimmomatic-0.32\trimmomatic-0.32.jar PE -phred33 C:\Users\kevluv93\Desktop\L11of2_S1_L001_R1_001.fastq.fq C:\Users\kevluv93\Desktop\L11of2_S1_L001_R2_001.fastq.fq C:\Users\kevluv93\Desktop\output_forward_paired.fq C:\Users\kevluv93\Desktop\output_forward_unpaired.fq C:\Users\kevluv93\Desktop\output_reverse_paired.fq C:\Users\kevluv93\Desktop\output_reverse_unpaired.fq ILLUMINACLIP:C:\Users\kevluv93\Desktop\Trimmomatic-0.32\Trimmomatic-0.32\TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

To make things simple, all the files are on my desktop, so if there is an error in the paths I gave trimmomatic to get the files, keep that in mind.

Here is the error message:

Multiple cores found: Using 4 threads
Trimmomatic PE: Started with arguments: -phred33 C:\Users...
Multiple cores found: Using 4 threads
Exception in thread "main" java.lang.NumberFormatException: For input string: "\Users\kevluv93\Desktop\Trimmomatic-0.32\Trimmomatic-0.32\TruSeq3-PE.fa
at java.lang.NumberFormatException.for InputString (unknown source)
at java.lang.Integer.parseInt(Unknown Source)
at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:53)
at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer (TrimmerFactory.java:27)

I don't know what is wrong with the script I put in. I used the example on the trimmomatic website as the base for this one, so I thought it would work. Did I input the script correctly? Do the parameters make sense?

New to this, undergrad, greatly appreciative of any input!

[mastal]

What was the trimmomatic command that you used, and what sequences did you use in the adapters fasta file?

[tsangkl]

Hi, I have successfully trim the transposase sequence from the Hiseq data using trimmomatic, but I would like to trim the primer as well, it only has 15 base long, and I see it is fail to trim it using trimmomatic, do I need to change the seed length of 16 base? How can it be done? Thanks